Phenotypic Mutation 'yuki' (pdf version)
List |< first << previous [record 4 of 17] next >> last >|
Alleleyuki
Mutation Type missense
Chromosome15
Coordinate11,001,092 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Chromosomal Location 11,000,721-11,029,233 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Mapped Yes 
Amino Acid Change Serine changed to Arginine
Institutional SourceBeutler Lab
Ref Sequences
S92R in Ensembl: ENSMUSP00000022851 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:MFS_1 36 364 1.3e-9 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000022851)
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(15) : Targeted, other(3) Spontaneous(5) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 nonsense
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 missense probably benign 0.05
galak UTSW 15 11012667 nonsense
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
voldemort UTSW 15 unclassified
zuckerkuss UTSW 15 11025935 critical splice donor site
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.00
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository
Last Updated 2018-08-01 4:32 PM by Diantha La Vine
Record Created 2011-02-22 9:49 PM by Wataru Tomisato
Record Posted 2011-08-25
Phenotypic Description

The yuki mutation was induced by ENU on the C57BL/6J (black) background and discovered in G3 animals. The mutant mice exhibit a “dirty white” coat color and reddish eyes (see figure).  They responded normally in the in vivo CpG screen.

Nature of Mutation

Because the phenotype of yuki mice is similar to that of Slc45a2 mutants cardigan, galak, grey goose, june gloom, nilla, sweater, zuckerkuss, the Slc45a2 gene was directly sequenced.  A T to G transversion at position 372 of the Slc45a2 mRNA was detected.  The mutation occurs in the first of seven exons.

 

355 GTGGTGGGATCAGCCAGTGATCACTGCAGGGCC

87  -V--V--G--S--A--S--D--H--C--R--A-

 

The mutated nucleotide is indicated in red lettering, and causes a serine to arginine substitution at amino acid 92 of Slc45a2.

Protein Prediction
Figure 1. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The yuki mutation (red asterisk) causes a serine to arginine substitution at amino acid 92 of the SLC45A2 protein. This image is interactive. Click on the mutations for more specific information.  

The yuki mutation affects a serine residue in the 16-amino acid cytosolic loop between transmembrane helices 2 and 3. 

 

Please see the record for cardigan for more information about Slc45a2.

Primers Primers cannot be located by automatic search.
Genotyping

Yuki genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

Yuki (F): 5’- GAGGCACAAGCATTCTAAGGACCC -3’

Yuki (R): 5’-AGTGGCTCAAAACTCCTTCGACTG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

 

Primers for sequencing

Yuki_seq(F): 5’- ATGCTTCCGAGTGCCAAC -3’

Yuki_seq(R): 5’- CTTGCAATAATAAAAGGCAGCGTC -3’

 

The following sequence of 925 nucleotides (10930336-10931260 bp of the NCBI Reference Sequence for chromosome 15) is amplified:

                      gaggcacaag cattctaagg accccgaggg ctcacagcag

ctaatctctg tcatgcttcc gagtgccaac gccccctttg cttctcaccg taacttgtga

tcttggaggc atgaaagaat ttcagcccct cctccagcct gaccatctct gttggttgct

ctgacaggct ccatgtcaga cccggtttgg agcacaaatc tgaggaccac gcaagaaggc

tattttctcc gtggtcatga gtggaagcaa tgggccgact gacacccata cctatcaatc

cttagccgag gattgcccct ttggctctgt ggagcaaccc aagagatcca cagggagact

tgtcatgcac agcatggcca tgtttggccg agagttttgc tatgcggtgg aggcagctta

tgtgactcca gttctgctca gcgtgggcct gcctaagagc ctgtacagca tggtgtggct

cctaagcccc atcttgggat tcctgctcca gcctgtggtg ggatcagcca gtgatcactg

cagggcccgt tggggtcgcc ggagaccata catcctgact ctggccatta tgatgctctt

gggaatggct ctgtacctca atggagatgc ggtcgtatca ggtaagtgga tcgcacagat

cccatagtta actgctgggt taaaatgtca tcagtatttt ttaatgccgc atagaaaatg

gctagaacta acgttctctc tctctcagca tgcagtgacc tccctcccac ctttggatga

ccccgagcct ggggctgagg ggcttttact tccagaacca tctcgacgct gccttttatt

attgcaaggt tttaaaaatg ggattgagct tatatctatt tcatcaaatt atattcttaa

aaattatttt tatttattta ccagtcgaag gagttttgag ccact

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsWataru Tomisato, Bruce Beutler
List |< first << previous [record 4 of 17] next >> last >|
Edit History
2011-08-25 11:54 AM (current)
2011-08-25 10:51 AM
2011-08-25 10:42 AM
2011-08-25 10:34 AM