Phenotypic Mutation 'allia' (pdf version)
List |< first << previous [record 12 of 511] next >> last >|
Alleleallia
Mutation Type missense
Chromosome1
Coordinate165,855,214 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Cd247
Gene Name CD247 antigen
Synonym(s) CD3-zeta, CD3 zeta, Tcrz, T3z, Cd3h, TCRk, CD3-zeta/eta, Cd3z, CD3zeta, 4930549J05Rik, CD3-eta
Chromosomal Location 165,788,681-165,877,277 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit greatly reduced numbers of CD4+CD8+ cells, and near absence of CD4+CD8-, CD4-CD8+ cells, and TCR expression in the thymus, but the presence of single positive T cells in lymph nodes.
Accession Number

NCBI RefSeq: CD247 antigen isoform zeta precursor (NM_001113391.2); CD247 antigen isoform iota precursor (NM_001113392.2); CD247 antigen isoform theta precursor (NM_001113393.2); CD247 antigen isoform kappa precursor (NM_001113394.2); CD247 antigen isoform eta precursor (NM_031162.4); MGI:88334

Mapped Yes 
Amino Acid Change Aspartic acid changed to Valine
Institutional SourceBeutler Lab
Ref Sequences
D36V in Ensembl: ENSMUSP00000083165 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.8e-17 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000083165)
Phenotypic Category hematopoietic competition - disadvantage, immune system
Penetrance unknown 
Alleles Listed at MGI

All alleles (9) : Targeted (9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Cd247 APN 1 165857417 missense probably damaging 1.00
R1114:Cd247 UTSW 1 165788838 missense possibly damaging 0.56
Z1088:Cd247 UTSW 1 165866663 missense noncoding transcript
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
MMRRC Submission 036308-MU
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created 03/25/2011 8:09 PM by Owen M. Siggs
Record Posted 11/03/2011
Phenotypic Description
Figure 1.  Dot-plot representation of the hematopoietic lineages from the allia index mouse, J3808 (CD45.2+).  The allia mouse was sublethally irradiated and injected with wild-type bone marrow cells (CD45.1+).  Flow cytometry analysis found that the allia CD4+ T cells (Cd4+CD44lo and CD4+CD44hi) were outcompeted by wild-type cells; the other hematopoietic cell types repopulated normally.

The allia phenotype was identified in a screen of G3 mice that were sublethally irradiated and then intravenously injected with wild-type bone marrow cells (CD45.1+).  Flow cytometry analysis was used to assess the contribution of bone marrow cells from the G3 mice (CD45.2+) and those from the wild type to the reconstitution of the hematopoietic compartment.  The allia CD4+ T cells were outcompeted by wild type cells but the other allia hematopoietic cell types repopulated normally (Figure 1). 

 

 

Nature of Mutation

The allia mutation was mapped by bulk segregation analysis (BSA) of progeny from intercrosses of (C57BL/10J x C57BL/6J-allia) F1 mice (n=11 with mutant phenotype, 25 with normal phenotype).  The mutation was near the marker B10SNPSG0020 at position 173342737 on Chromosome 1 (synthetic LOD = 5.9971).  Sequencing of the candidate gene, Cd247, which was within the critical region, identified an A to T transversion at position 255 (in exon 2 of 8 exons) of the mRNA sequence of Cd247 (NM_001113391.2), encoding CD3 zeta (ζ) and CD3 eta (η) .   The mutation is 5.56 Mb from the marker with peak linkage.

 

235  CAAACTCTGCTACTTGCTAGATGGAATCCTCTTCATCTACGG

30   --K--L--C--Y--L--L--D--G--I--L--F--I--Y--G

 

The mutated nucleotide is indicated in red lettering and causes a D to V substitution at residue 36 of the CD3ζ protein.

Protein Prediction

The T-cell receptor (TCR) complex is composed of several subunits: (i) a TCR alpha/beta (α/β) or TCR delta/gamma (δ/γ) heterodimer; (ii) two CD3 epsilon (ε) chains (see tumormouse), one dimerized with a CD3γ chain, the other with a CD3δ chain, and (iii) a CD3ζ homodimer or a CD3ζ/η heterodimer (1-6).

 

Cd247 has 5 isoforms: ζ, η, theta (θ), iota (ι) and kappa (κ). The ζ, η, and θ transcripts are protein-coding; the ι and κ transcripts are non-coding. The ζ transcript is the shortest; the θ, κ, η and ι variants are longer than ζ and have distinct C-termini from ζ due to alternate exon structures in the 3’ coding region and 3’ untranslated region (NC_000067.5). The CD3ζ (P24161) and CD3η (P29020) proteins are units of the TCR-CD3 complex that are encoded by alternatively spliced transcripts of Cd247 (7-9). The CD3ζ transcript is 1.315 kb with a coding region of 492 bp and a 906 bp 3’ untranslated region encoded by exon 8 (of 8) (10). Alternative splicing of the CD3ζ transcript at two internal (5′ and 3′) splice sites within the 3′-UTR results in deletion of nucleotides 672–1233 and generation of a 344-bp alternatively spliced variant. The 344-bp CD3ζ isoform lacks two critical regulatory adenosine/uridine-rich elements (ARE) and a translation regulatory sequence (10). As a result, the isoform’s stability and translation are significantly lower than that of the 906-bp CD3ζ isoform leading to a decrease in the amount of protein that is expressed (10). The CD3ζ/η locus can also encode the ubiquitously expressed transcription factor, Oct-1, on its opposite strand (9). Oct-1 is a member of the POU domain transcription factor family and has roles in neural development, cell growth, differentiation, cell stress and metabolic signaling (11). In a study that used targeted disruption of the CD3η gene, reduction in the expression level of Oct-1 transcripts was observed (7).

 


Figure 2.  Domain Structure of CD3ζThe allia mutation results in a conversion of an Aspartic acid to Valine at amino acid 36 of the encoded protein.  SP, Signal peptide; EC, extracellular domain; TM transmembrane domain; ITAM, cytoplasmic immunoreceptor tyrosine-based activation motifs.

The proteins encoded by the CD3ζ and CD3η transcripts are structurally homologous to each other, but distinct from the CD3γ, δ, and ε chains (1;12). The CD3γδε chains have an Ig-like extracellular domain, a transmembrane domain and a cytoplasmic tail (13). In contrast, the 164 amino acid, 18 kDa CD3ζ and the 206 amino acid, 24 kDa CD3η chains have an N-terminal signal peptide (aa 1-21), nine extracellular amino acids (aa 22-30), a helical transmembrane domain (aa 31-51) and a cytoplasmic domain (aa 52-164, CD3ζ; aa 52-206, CD3η) (1;3;14) (Figure 2). CD3ζ’s cytoplasmic domain can mask internalization motifs of other CD3 family members, allowing for enhanced expression of the TCR-CD3 complex at the cell surface (4). To control premature activation of the receptor, the CD3ζ tyrosines that are phosphorylated upon receptor activation are buried within the membrane (15). All of the CD3 proteins have immunoreceptor tyrosine-based activation motifs (ITAMs) at their cytoplasmic tail that are essential in transducing the TCR activation signal across the membrane (4;7;9). The ITAM motif is comprised of a tyrosine (Y) residue, two other amino acids (x) and a leucine or isoleucine (L/I) residue (YxxL/I). The sequences are separated from each other by 7-12 amino acids (TxxL/Ix(7-12)TxxL/I). CD3η and CD3ζ chains have three of these motifs (aa 61-89, 100-128, 131-159 in CD3ζ; 61-89, 100-128 in CD3η), the others have one (3). In the complete TCR-CD3 complex, the ITAMs of the CD3 proteins provide ten phosphorylation sites that facilitate the recruitment of ZAP-70 (see murdock, mrtless, trebia and wanna), a tyrosine kinase essential for downstream signaling, to the receptor complex (3). Upon receptor activation, phosphorylation of CD3ζ ITAM domains signals for the continual internalization and recycling of the TCR-CD3 complex and its subsequent degradation within lysosomes (16).

 

Figure 3.  Three dimensional representation of the CD3ζ homodimer (PBD: #2HAC) (5).  The allia mutation is at D36 in the transmembrane domain of CD3ζ, a residue essential for dimerization of the CD3ζ chains and for their association with the TCR.

The CD3ε/γ, ε/δ, ζ/ζ and ζ/η dimer formation and their association with the TCR chains are essential for receptor cell surface expression and subsequent T cell activation. CD3γ, δ, and ε have a CxxCxExx motif (C = cysteine, E = glutamic acid and x = any amino acid) in their extracellular domains. Intra-chain disulfide bonds between cysteine residues within these motifs in adjacent chains and hydrogen bonds between the extracellular domains of the CD3ε and either the δ or γ chains facilitate the formation of dimers (4;13). The TCR and CD3 subunits associate with each other through charged (aspartic or glutamic acid) residues within their transmembrane domains (4;15).

 

Most TCR-CD3 complexes contain a disulfide bonded CD3ζ homodimer; 5-10% of the complexes contain a CD3 zeta/eta (ζ/η) heterodimer (7). The TCR complex can also associate with homodimers of the receptor for IgE (FcεRIγ), which shares structural homology to CD3ζ and CD3η and is predominantly expressed on mast cells, basophils and FcRγ+ T cells (e.g. the LGL T cell line) (12;17;18). Studies have shown that in the absence of CD3ζ/η or CD3ζ/ζ dimers, a FcεRIγ homodimer is incorporated into the TCR-CD3 complex, expressed at the cell surface, and activated T cell receptor-mediated signal transduction and subsequent interleukin (IL)-2 production occurs (12;17;19;20).

 

The three dimensional structure of the CD3ζ homodimer has been determined (Figure 3) (5).  The allia mutation results in an aspartic acid (D) to valine (V) amino acid change at residue 36 within the transmembrane domains of both CD3ζ and CD3η.  The transmembrane structure of the CD3ζ homodimer has been extensively studied and it has been determined that D36 is one of 8 residues within the transmembrane domain that is essential for the dimerization of the CD3ζ chains (5;21;22).  The two aspartic acids pack closely within the interface of the transmembrane domain.  Although substitution of D36 with a nonpolar head group (e.g. valine, as in allia) has not been studied, substitution with a polar head group (e.g. asparagine or serine) reduced the dimer formation by ~40% (5).  Mutations at D36 have been shown to disrupt dimer formation by the prevention of disulfide bond formation (between Cys32 on adjacent chains) (5).  In addition, D36 seems to be essential for creating a unique structural scaffold between the CD3ζ side-chains, the cysteines at residue 32, and water molecule(s) that are required for association with the TCR (5;21;22).

Expression/Localization

The 31 kb Cd247 gene is conserved in human, chimpanzee, cow, rat, and chicken (NC_000067). In the mouse, the Cd247 transcripts appear early in gestation, with the CD3ζ and CD3η transcripts detected as early as gestational days 15 or 16 (9). In the early stages of T cell development, the mRNA levels of CD3ζ and CD3η remain constant (9). However, in mature cells the levels drop 10-fold and then remain constant when the TCR-mediated developmental signal is no longer needed (9). Both transcriptional and post-transcriptional regulatory mechanisms determine the expression levels of CD3ζ and CD3η mRNA (9).

 

The TCR-CD3 complex is formed in the endoplasmic reticulum (ER) and provides a quality checkpoint for the complex in that the residues that are essential to stabilize the complex can also act as degradation signals for the incomplete complexes (15;23).  Although incomplete CD3 dimers and TCR-CD3 complexes are retained in the endoplasmic reticulum (ER), it has been proposed that CD3ζ can mask the ER retention motifs of the CD3 chains allowing for incomplete TCR-CD3 complexes to be transported to the cell surface (4). CD3ζ also has a role in facilitating surface expression of the TCR-CD3 complex and maintaining the integrity of complete and partial TCR-CD3 complexes through sequences near its transmembrane domain (1;2;9;24). Studies have also shown that a significant amount of tyrosine-phosphorylated CD3ζ accumulates in perinuclear endosomal vesicles with recycled TCR complexes and can activate TCR-mediated signaling, possibly acting as a substrate of the Src-family kinase, Lck, that is present on Rab11-positive endosomes, a subset of ribosomes that are essential for endocytic recycling (16;25).

Background

Induction of a cell-mediated adaptive immune response requires T cell receptor recognition and binding of a peptide presented by the major histocompatibility complex (MHC) on an antigen presenting cell (APC) (i.e. dendritic cells, macrophages and B cells) (6). Binding of the peptide-MHC complex activates the T-lymphocyte, facilitating its proliferation and differentiation into effector cells; lymphokine secretion from the effector cell contributes to the adaptive immune response (1;3;4;26) The T cell originates in the bone marrow as a hematopoietic stem cell that, upon expression of cell surface markers such as c-Kit, CD44 and CD25, transitions to a common lymphoid progenitor. Migration of the T-cell progenitor from the bone marrow to the thymus facilitates its maturation and positive selection via recognition of a foreign peptide presented by a self MHC protein. Two classes of T cells can be activated upon detection of an antigen, helper T cells, and cytotoxic T cells. The helper T cells activate other cells such as macrophages, B cells, and the cytotoxic T cells while the cytotoxic T cells act directly on the cells that are infected. Efficient T cell activation, maturation, and migration are essential to remove invading pathogens and to maintain self-tissue tolerance. Improper thymocyte development/maturation are observed in autoimmune disorders such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), transplant rejection, and chronic viral infections (4;27;28).

 

There are two transmembrane protein units on the T cell that are essential for the activation of intracellular signaling upon recognition of an MHC peptide during an adaptive immune response: the CD4 (see thoth) or CD8 co-receptors and the TCR-CD3 complex (3) (Table 1).

 

Table 1: TCR-CD3 complex units and their functions

Protein

Expressed on

Functions

CD4

Helper T cells

Recognizes Class II MHC; promotes adhesion to antigen-presenting cells and target cells; signals T cells

CD8

Cytotoxic T cells

Recognizes class I MHC; promotes adhesion to antigen-presenting cells and infected target cells; signals T cells

TCRα/β, δ/γ

All T cells; mostly α/β heterodimer,δ/γ by intraepithelial lymphocytes

Determines antigen specificity; binds to MHC-bound peptide

CD3ε/γ,ε/δ

All T cells

Facilitates TCR-CD3 complex assembly, cell surface expression and T cell activation

CD3ζ/ζ, ζ/η

All T cells; mostly ζ/ζ homodimer

Facilitates TCR-CD3 complex assembly, cell surface expression and T cell activation; ζ/ζ prevents the other TCR-CD3 chains from being degraded post-Golgi; ζ/ζ sustains TCR-CD3 signaling after receptor internalization; invariant natural Killer T (iNKT) cell development; neural circuitry development of the retina; transitional stage from CD4/CD8 DN to CD4+/CD8+ DP cells and/or in terms of survival and expansion of the DP cells

 

Helper T cells display CD4 on their cell surface and produce a subset of cytokines (lymphokines) through the initiation of intracellular signaling upon the recognition of MHC class II molecules on APCs. CD8-presenting cells are cytotoxic T cells and promotes the death of the infected cell upon recognition of MHC class I molecules on APCs (6). During thymocyte maturation, the earliest T cell precursor is a CD4/CD8 double negative (DN) lymphoid cell (4). As maturation progresses, the DN cell signals the T cell to proceed to either a TCRα/β or a TCRδ/γ cell lineage and to further differentiate to a CD4+/CD8+ double positive (DP) cell (4).

 


Figure 4.  TCR-CD3 complex-mediated intracellular signaling.  The TCR-CD3 complex and the CD4 co-receptor recognizes and binds a peptide presented by the major histocompatibility complex (MHC) on an antigen presenting cell (APC).  The T-cell receptor (TCR) complex is composed of a TCR alpha/beta (α/β) heterodimer; two CD3 epsilon (ε) chains (see tumormouse), one dimerized with a CD3γ chain, the other with a CD3δ chain; and a CD3ζ homodimer. Following T cell activation, CD3ζ is phosphorylated at its ITAM motifs by the kinases, Lck or Fyn.  ZAP-70 (see murdock, mrtless, trebia and wanna) binds to the phosphorylated ITAM motifs, is phosphorylated, and stimulates downstream signaling by phosphorylating adaptor proteins such as linker of activated T cells (LAT), Src homology 2 (SH2) domain-containing leukocyte protein (SLP-76) and phospholipase C (PLC).  LAT phosphorylation mediates the recruitment of SLP-76, Ras, Vav, or PLC to CD3ζ ITAMs leading to the activation of the Ras/Raf/mitogen-activated protein kinase and the Rac pathways.  In the nucleus, the PLC and Ras pathways converge and initiate the transcription of cytokines that assist in T cell proliferation. The Rac pathway assists in T cell differentiation, while the SLP-76 branch of the TCR-mediated signaling leads to allelic exclusion.

Within the TCR-CD3 complex, the TCR heterodimer determines antigen specificity by recognizing and binding the MHC-bound peptide (12;14). The TCR heterodimer is usually comprised of an α and β chain; δ/γ heterodimers comprise ~2% of the complexes, mostly on intraepithelial lymphocytes. Both the cytotoxic and helper T cells consist of a TCR heterodimer that are encoded by site-specific recombination of V, D, and J gene segments during T cell development in the thymus.

 

The CD3 complex (the CD3ε/γ, ε/δ heterodimers, and the CD3ζ/ζ homodimer (or CD3ζ/η heterodimer)) facilitates intracellular TCR-CD3 complex assembly and its subsequent surface expression. In addition, the CD3 complex promotes T cell receptor-mediated signaling (i.e. antigen recognition activating thymocyte differentiation) by interactions with different intracellular adaptors and kinases (1;4;13;15;29;30).  

 

Analysis of the function of CD3η within the CD3ζ/η heterodimer has not been conclusive. Some studies indicate that the η chain is essential for phosphatidylinositol (PI) hydrolysis and activation-induced apoptosis of T cell hybridomas (31;32).   Hydrolysis of PI to inositol-1,4,5-triphosphate (IP3) and diacylglycerol affects NF-AT and NF-κB transcription factor activation, respectively (33).   PI hydrolysis, along with an increase in intracellular calcium, are prerequisites for the induction of cytokines such as IL-2 following TCR activation (33). In contrast to the findings that CD3η has an essential role upon T cell receptor activation, other studies have shown that PI hydrolysis is induced by TCR complexes containing a ζ homodimer (34;35) and that mice homozygous for a mutation inactivating the CD3η gene developed normal thymocytes and mature T cells (7).

 

The CD3ζ chains have several documented functions:

  1. The CD3ζ homodimer within the CD3 complex prevents the other TCR-CD3 chains from being degraded post-Golgi, presumably through the lysosome (30). Phosphorylated CD3ζ also helps to sustain TCR-CD3 signaling after receptor internalization (16).
  2. CD3ζ ITAMs have also been implicated in the development of invariant natural Killer T (iNKT) cells, a group of T cells that share properties of T cells and natural killer cells (36)
  3. In the retina of CD3ζ deficient mice (CD3ζ-/-), there was reduced retinal ganglion cell (RGC) dendritic motility, an increase in RGC dendritic density, and a defect in the glutamate-receptor (GluR)-mediated synapse activity that affects neural circuitry (37).  The mature CD3ζ-/- retina displayed an enhanced inner retinal response to light.
  4. The CD3ζ homodimer participates in intracellular signaling pathways following activation of the T cell (Figure 4). Following T cell activation, CD3ζ is phosphorylated at its ITAM motifs by Src-family kinases (p56Lck or p59Fyn). It is unclear whether changes in CD3ζ conformation, the phosphorylation of CD3ζ ITAM motifs, or a combination of both is responsible for activating downstream signaling cascades (4). A tyrosine kinase (ZAP-70) binds to the phosphorylated ITAM motifs and is itself phosphorylated (either by auto-phosphorylation or by the kinases Lck or Fyn) (14;38). RhoH, a member of the Ras homology family that functions in actin reorganization of the cytoskeleton, has been implicated to play an adaptor role in ZAP-70 and Lck recruitment to the TCR-CD3 complex (38).  Phosphorylated ZAP-70 stimulates downstream signaling by phosphorylating adaptor proteins such as linker of activated T cells (LAT), Src homology 2 (SH2) domain-containing leukocyte protein (SLP-76), and phospholipase C (PLC) (1;3;15;27;39). LAT phosphorylation mediates the recruitment of SLP-76, Ras, Vav, or PLC to CD3ζ ITAMs leading to the activation of the Ras/Raf/mitogen-activated protein kinase and Rac pathways (3;4;27).  In the nucleus, the PLC and Ras pathways converge and transcription factors such as AP-1 and NFAT initiate the transcription of cytokines that assist in T cell proliferation and T-cell effector responses (27).
  5. CD3ζ is required for thymocyte development at the transitional stage from DN to DP cells and/or in terms of survival and expansion of the DP cells (7;17). In the absence of CD3ζ, DN thymocytes are able to progress to DP cells only at a very low rate and fail to display TCR-CD3 on their cell surface (1;7). As a result, there is an increase in DN cells and a decrease in the numbers of DP and CD4+ or CD8+ single positive (SP) cells in the thymus (1).

 

The loss of Cd247 expression has been implicated in several human diseases. Examination of the T cells from several patients with SLE found that their cells expressed lower levels of CD3ζ or that it was not phosphorylated (10;28) In these cells, the TCR-CD3 complex recruited spleen tyrosine kinase (Syk) instead of ZAP-70 after receptor activation (10); Syk-related signaling promotes increased phosphorylation and calcium influx into the cells, but IL-2 expression is not induced (10). In another study, RT-PCR examination of the CD3ζ transcript sequence from several patients found either portions of exon 7 were deleted or point mutations within an ITAM domain (28)The T cells in patients with abnormal expression of CD3ζ but normal expression of the other TCR-CD3 complex members had impaired immune response to alloantigens, tetanus toxoid, and mitogens (OMIM: #610163). In other patients, a Q70X mutation in Cd247 led to primary T-cell immunodeficiency (40). Interestingly, in some patients with cancer, CD3ζ expression on T cells was reduced, leading to a loss in TCR-mediated signal transduction (14). Aberrant expression of Cd247 has also been implicated in hypertension (41), celiac disease, and rheumatoid arthritis (42).

Putative Mechanism

The A225T mutation in exon 2 of Cd247 generates a D36V mutation in the CD3ζ and CD3η proteins. D36 of CD3ζ and CD3η is within the transmembrane domain, an essential domain for protein interactions between the TCR and CD3 subunits (4;5;15). The charge of D36 in the transmembrane domain has been shown to be essential for protein-protein interactions (5). Also, the transition from a negative to a neutral charge at this residue may lead to: (i) a change in the conformation of the chain within the lipid bilayer of the membrane, decreasing its stability, (ii) alterations in the interactions with the other members of the TCR-CD3 complex, and/or (iii) retention of CD3ζ and CD3η in the ER and their subsequent degradation. Previous studies on CD3ε have shown that changes in the charge of its transmembrane domain (at residue 8) leads to ER retention and degradation in the ER (43)

Primers Primers cannot be located by automatic search.
Genotyping

Allia genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  The following primers are used for PCR amplification:

 

Primers for PCR amplification

Allia(F):  5’-ATGTCACCAGAGCAGAAGTTCTGTG-3’

Allia(R):  5’-GCCCTAAGAAGAGGCTGTCTTGTC-3’

 

Primers for sequencing

Allia_seq(F):  5’-TCTGTCACAGAATTGACCTGG-3’

Allia_seq(R):  5’-TGTCTGCCACAGATGGATAC-3’

 

PCR program

1) 94°C        2:00

2) 94°C        0:30

3) 57°C        0:30

4) 72°C        1:00

5) repeat steps (2-4) 29x

6) 72°C        7:00

7) 4°C           

 

The following sequence of 1042 nucleotides (from Genbank genomic region NC_000067 for linear genomic sequence of Cd247) is amplified:

 

    65821                                                  atgtcaccaga

    65881 gcagaagttctgtgcacagcagtttcattttttcctaatactccctcattcttcccagcc

    65941 tctgtggttacatctggtacatgtggttacattgtatgcatataggtgcactccttacat

    66001 ctggtacattggttacattgtatgcataggtgcactccttacatctggtacatgtggtta

    66061 cattgtatgcataggtgcactcgttacatctggtacaagtggttacattgtatgcatata

    66121 ggtgcactccttacatctggtacatgtggttacattgtatgcattggttcactcattaca

    66181 tctggtacatgtggttacattgtatgcattggtgcactcgttacatctggtacatgtggt

    66241 tacattgtatgcataggtgcactctttacatctggtacatgtggttacattggccattgc

    66301 aggctgggtttcttcagactcagtgagagaggttgtaggttgtggtctgtgtgaagtatg

    66361 aggactggacctagtgcccgtgacatgactacaatctgtcacagaattgacctggggtag

    66421 gtgggatgtgttcttgccagatccagcatgcctaaccaattttctctcttggcacagagg

    66481 cacagagctttggtctgctggatcccaaactctgctacttgctagatggaatcctcttca

    66541 tctacggagtcatcatcacagccctgtacctgagagcaaaagtgggttcccctgggctct

    66601 tgagggagggtataggttcctccactgggaggatgtgaggtggggatttggcactggaga

    66661 gtctcaggcctgtgctctgcttggtgtccatgggcaaggcaggatacaaccaagcgtgca

    66721 cagccggtgagcagagaaggcggggtatccatctgtggcagacagagcagctcaatgatc

    66781 caagtgctatgtgtattactgaagatcggtaccagtgcctggatgtggcttctgctggga

    66841 aacagatggcttatactgaacagtttaggacaagaaagtgaaagacagacaagacagcct

    66901 cttcttagggc

 

Primer binding sites are underlined; sequencing primers are highlighted; the mutated A is highlighted in red.

 

References
Science Writers Anne Murray
Illustrators Victoria Webster
AuthorsOwen Siggs, Sara Kalina
List |< first << previous [record 12 of 511] next >> last >|