Phenotypic Mutation 'spin2'

• Allele: spin2
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 124,709,332 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ptpn6
• Gene Name: protein tyrosine phosphatase, non-receptor type 6
• Synonym(s): Hcph, SHP-1, hcp, Ptp1C
• Chromosomal Location: 124,697,670-124,715,672 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P29351
• SMART Domains: Protein: ENSMUSP00000004377; Gene: ENSMUSG00000004266; AA Change: L88P

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000004377)
• SMART Domains: Protein: ENSMUSP00000108103; Gene: ENSMUSG00000004266; AA Change: L86P

Domain	Start	End	E-Value	Type
SH2	2	85	4.05e-28	SMART
SH2	108	200	1.45e-29	SMART
PTPc	243	517	7.51e-131	SMART
low complexity region	569	579	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112484)
• SMART Domains: Protein: ENSMUSP00000129124; Gene: ENSMUSG00000004266; AA Change: L88P

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000171549)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000133747; Gene: ENSMUSG00000004266; AA Change: L65P

Domain	Start	End	E-Value	Type
SH2	2	64	2.35e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000173647)
• SMART Domains: Protein: ENSMUSP00000133991; Gene: ENSMUSG00000004266; AA Change: L47P

Domain	Start	End	E-Value	Type
Pfam:SH2	1	40	3.5e-6	PFAM
SH2	69	161	1.45e-29	SMART
PTPc	204	478	7.51e-131	SMART
low complexity region	530	540	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000174265)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly nonessential (E-score: 0.481)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• MMRRC Submission: 034796-MU
• Last Updated: 2019-01-30 4:38 PM by Diantha La Vine
• Record Created: 2011-04-24 2:18 PM by Owen M. Siggs
• Record Posted: 2011-05-09
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Sara Kalina, Carrie Arnold, Owen Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_013545; MGI: 96055

Alleles Listed at MGI

All alleles(10) : Targeted, other(3) Gene trapped(1) Spontaneous(4) Chemically induced(2)

Phenotypic Description

The spin2 phenotype was discovered in an ENU-mutagenized G3 mouse during weaning.  The index mutant had swollen footpad lesions on both hind paws and one front paw, localized inflammation of the ear surrounding the ear tag, and was smaller than age-matched counterparts. The inflammation was likely microbe-dependent, and the phenotype resembled those of spin (spontaneous inflammation) mice that have a mutation in the Ptpn6 gene (1).

Nature of Mutation

Due to the phenotypic similarity to spin animals, the Ptpn6 gene was sequenced in the spin2 mutant and a T to C transition was identified at nucleotide 449 using Genbank record NM_013545 in exon 4 of 17 total exons.  

433 CAGCAGCAGGGCATCCTGCAGGACCGAGATGGC
81  -Q--Q--Q--G--I--L--Q--D--R--D--G-

The mutated nucleotide is indicated in red lettering, and results in a leucine to proline substitution at amino acid 86 of the encoded protein.

Protein Prediction

Figure 1. Domain structure of SHP1. The position of the spin2 mutation is indicated. Other mutations found in SHP1 are noted in red. Click on the mutations for more specific information.

The spin2 mutation results in the substitution of a leucine for a proline in the N-terminal SH2 (Src-homology 2) domain of the SHP1 protein tyrosine phosphatase.  This amino acid is present in all SHP1 isoforms and is highly conserved amongst SHPs and homologous proteins.  The N-terminal SH2 domain keeps the enzyme in an inactive conformation by binding to the catalytic domain. Engagement of the C-terminal SH2 domain by phosphotyrosine-containing partners leads to a conformational change in the N-terminal SH2 domain, opening its phosphopeptide-binding pocket to ligands. Together, binding of both SH2 domains to partners destabilizes the autoinhibited conformation of SHP1. The Leu86 residue of SHP1 is located in the seventh β-strand of the N-terminal SH2 domain, a region that is involved in blocking the binding of phosphotyrosine ligands to the catalytic site (2). It is possible that the proline substitution could lead to increased SHP1 activity.  However, the phenotype of spin2 animals suggests decreased SHP1 function, and optimal signaling through SHP1 requires both SH2 domains.  

The phenotype of spin2 animals is slightly more severe than the spin phenotype with onset of inflammation occurring approximately two weeks earlier.  The phenotype of spin animals is significantly less severe than the Ptpn6^me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (3).  It is likely that the SHP1 protein encoded by the spin2 allele retains catalytic activity that is greater than 20% of normal, but less than the SHP1 protein encoded by the spin allele.

For more information on Ptpn6, please see the record for spin.

Primers

Primers cannot be located by automatic search.

Genotyping

Spin2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

Spin2(F): 5’- TGGCCTCTCTGTTACTCTCAGGATG -3’

Spin2(R): 5’- TTTAGGTGGTTTCACCGGGACCTC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

Spin2_seq(F): 5'- TTGCTAGGCAGCAGGAACC -3'

Spin2_seq(R): 5'- AGAACCAGGGTGACTTCTCC -3'

 

The following sequence of 830 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 6, bases 124,682,054 to 124,682,883) is amplified:

 

tttaggtggt ttcaccggga cctcagcggg cctgatgcag agaccctgct gaagggccgg
ggagtccctg ggagcttcct ggctcggccc agccgcaaga accagggtga cttctccctc
tcagtcaggt gggtggccct ccctgcacct tggcagctca ttgtgtgggt ccggagcatt
cctgggttcc ctgggttgtg ttgtctcctc atgatacatt tcttcccttc tgtccctgcc
tgtcgcccta gcatgtgccc ataactgtct atgtctactc catgcctatg tgcttttgca
tcgagacccc tgtcccccca agcccacccc gctgctgctc atgtatctca ctacctggtg
gtgcctcgca gggtggatga tcaggtgact catattcgga tccagaactc aggggacttc
tatgacctgt acggagggga gaagtttgcg acgctgacag agctggtcga gtattacacg
cagcagcagg gcatcctgca ggaccgagat ggcaccatca tccaccttaa gtacccactg
aactgctcgg accccaccag tgagaggtga ggggcattgc aggttggccc tgtcccttga
gataagtgga catccagacc aggtgtcctt ctgttcccag tccgttcttc atccctgatc
ttccacacct gttctctcag tgttctcagc ctcttccctc tgtaggctga tgattcccat
gtatctaacc aatcccctgt cccctgagga agccagagaa gggttcccct tgccttcctg
cagggttcct gctgcctagc aacctcatcc tgagagtaac agagaggcca

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

 1.  Croker, B. A., Lawson, B. R., Berger, M., Eidenschenk, C., Blasius, A. L., Moresco, E. M. Y., Sovath, S., Cengia, L., Shultz, L. D., Theofilopoulos, A. N., Pettersson, S., and Beutler, B. (2008) Inflammation and autoimmunity caused by a SHP1 mutation depend on IL-1, MyD88, and a microbial trigger, Proc. Natl. Acad. Sci. ,USA , 105, 15028-15033.

2.  Yang, J., Liu, L., He, D., Song, X., Liang, X., Zhao, Z. J., and Zhou, G. W. (2003) Crystal structure of human protein-tyrosine phosphatase SHP-1, J. Biol. Chem. 278, 6516-6520.

3.  Kozlowski, M., Mlinaric-Rascan, I., Feng, G. S., Shen, R., Pawson, T., and Siminovitch, K. A. (1993) Expression and catalytic activity of the tyrosine phosphatase PTP1C is severely impaired in motheaten and viable motheaten mice, J. Exp. Med. 178, 2157-2163.