Phenotypic Mutation 'crusty2' (pdf version)
List |< first << previous [record 92 of 511] next >> last >|
Allelecrusty2
Mutation Type splice donor site (6 bp from exon)
Chromosome18
Coordinate43,999,935 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Spink5
Gene Name serine peptidase inhibitor, Kazal type 5
Synonym(s) 2310065D10Rik, LEKT1
Chromosomal Location 43,963,235-44,022,501 bp (+)
MGI Phenotype Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration.
Accession Number

Ncbi Refseq:NM_001081180.1; MGI:1919682

Mapped Yes 
Limits of the Critical Region 15408000 - 46803000 bp
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000066214 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Phenotypic Category immune system, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All alleles(3) : Targeted(2) Transposon induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice donor site probably benign 0.00
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 1.00
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.01
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense probably damaging 1.00
IGL01629:Spink5 APN 18 43996610 splice acceptor site probably benign 0.00
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.00
IGL02237:Spink5 APN 18 44012867 missense probably damaging 0.96
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 0.99
IGL02425:Spink5 APN 18 43990744 splice site 0.00
IGL02552:Spink5 APN 18 43992168 missense probably damaging 1.00
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.10
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.73
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.01
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice donor site probably null
R0648:Spink5 UTSW 18 43999797 splice acceptor site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.03
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1669:Spink5 UTSW 18 43969278 splice acceptor site probably benign
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.03
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.03
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.94
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
Repository
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created 05/10/2011 8:11 PM by Wataru Tomisato
Record Posted 12/05/2012
Phenotypic Description

Crusty2 is a visible phenotype identified in F2 mice (Figure 1).  Although the phenotype resembles crusty, crusty2 is not caused by a mutation in Foxp3.  Both the crusty and crusty2 lines exhibit hard, flaky/scaly skin on their ears and tails (Figure 2).  There is also the appearance of open wounds and scar tissue with a concomitant loss of hair on the face.  Viability in the crusty2 mice is low; few survive past weaning.

Figure 1.  Pedigree map of the crusty2 mouse line.


Figure 2.  The crusty2 phenotype.

Neutrophil content was assayed using fluorescence activated cell sorting (FACS) with splenocytes and lymph node cells stained with antibodies agains CD11b, Ly6G, and F4/80 (CD11b+Ly6G+F480- cells were recognized as neutrophils). FACS analysis revealed that the crusty2 mice had 3-30 times more neutrophils in their spleens and lymph nodes than WT (Table 1).  However, animals with transplanted bone marrow had no difference in the amount of neutrophils in animals transplanted with wild-type (WT) or crusty2 bone marrow cells (Table 2).  Furthermore, neither the crusty2 nor WT transplanted cells led to skin lesions.

Table 1

 

Ly6G+, F4/80- cells

Strain

Sex (M/F)

Organ Examined

% of CD11b+

% of total

WT

M

Spleen

23.5

0.731

crusty2

M

Spleen

42.4

2.89

WT

F

Spleen

18.4

0.729

crusty2

F

Spleen

31.9

4.12

WT

M

Lymph nodes

1.77

0.024

crusty2

M

Lymph nodes

25.2

0.599

WT

F

Lymph nodes

3.55

0.040

crusty2

F

Lymph nodes

21.0

0.515

 

Table 2

 

Ly6G+, F4/80- cells

Transplant (To-->From)

Sex (M/F)

Organ Examined

% of CD11b+

% of total

WT-->WT

M

Spleen

4.5

0.2

WT-->WT

M

Spleen

5.8

0.3

WT-->WT

M

Spleen

8.0

0.3

crusty2-->WT

M

Spleen

5.4

0.2

crusty2-->WT

M

Spleen

7.1

0.2

WT-->WT

F

Spleen

4.7

0.2

WT-->WT

F

Spleen

7.0

0.3

crusty2-->WT

F

Spleen

4.5

0.2

crusty2-->WT

F

Spleen

6.4

0.3

WT-->WT

M

Lymph nodes

0.6

0.0

WT-->WT

M

Lymph nodes

0.7

0.0

WT-->WT

M

Lymph nodes

0.4

0.0

crusty2-->WT

M

Lymph nodes

0.4

0.0

crusty2-->WT

M

Lymph nodes

0.8

0.0

WT-->WT

F

Lymph nodes

0.7

0.0

WT-->WT

F

Lymph nodes

1.7

0.1

crusty2-->WT

F

Lymph nodes

1.0

0.0

crusty2-->WT

F

Lymph nodes

1.0

0.0

 

Nature of Mutation

The crusty2 mutation was mapped using bulk segregation analysis (BSA) of F2 backcross offspring using C57BL/10J as the mapping strain (8 mutant and 23 normal).  The mutation showed strongest linkage with marker B10SNPSG0180 at position 35366160 bp on Chromosome 18 (synthetic LOD = 4.0).  Whole genome SOLiD sequencing of a homozygous crusty2 mouse and validation by capillary sequencing identified a T to G transition at bp 44159589 (6 bp after exon 17, within the donor splice site consensus sequence), 8.8 Mb from the marker of peak linkage, on chromosome 18 in the Genbank genomic region NC_000084, in Spink5.  A secondary, incidental mutation was also found in Tcerg1 (a factor associated with transcriptional elongation and pre-mRNA splicing; data not shown).

 

                <--EXON 17  INTRON 17     EXON 18-->

1669  ...ATGTGTTGGGCCTTCTT  GTGAGTATA...  CCAGCAAGAAGCCAA...

532   ...-M--C--W--A--F--F                --Q--Q--E--A--K...

 

The mutated nucleotide is indicated in red lettering, the donor splice site consensus sequence is in blue.  cDNA sequencing is underway to determine the changes to the Spink5 mRNA that occur upon the crusty2 mutation.

Protein Prediction

Figure 3. Comparison of human and murine LEKTI protein domains. (A) The 1064 amino acid human LEKTI based on Ensemble 256084. (B) Murine LEKTI based on Ensemble 69245. The crusty2 mutation is a G to T substitution between exons 17 and 18. Murine Spink5 lacks a domain corresponding to human SPINK5 domain 6 (shown in purple). Canonical Kazal-like domains contain 6 cysteine residues (shown in green).  Both human and murine LEKTI proteins contain several inhibitory domains that contain Kazal-type-derived four-cysteine residue patterns (shown in pink).

FIgure 4. Human LEKTI domain one. Structure based on NMR spectroscopy. While similar in overall structure, domains 1 and 6 (see Fig. 5, below) have markedly different conformations in their central regions. Unlike the structure of domain 6, this putative 3D structure contains a helical hairpin structure differing from any known proteinase inhibitors. Figure adapted from PDB:1HDL and Lauber T, et al. J Mol Bio, 2003, 328. Molecule created with The PyMOL Molecular Graphics System, Version 1.5.0.4 Schrödinger, LLC.

Figure 5. Human LEKTI domain six. This putative domain structure shows characteristics of classical Kazal-type inhibitors: three α helices and a β-hairpin. Unlike the three disulfide bonds in classical Kazal-type domains, this domain lacks a third disulfide bond and third β strand. This domain is not present in murine Spink5.  Figure adapted from PDB:1H0Z and Lauber T, et al. J Mol Bio, 2003, 328.  Molecule created with The PyMOL Molecular Graphics System, Version 1.5.0.4 Schrödinger, LLC

Computational analysis of mouse skin found that the transcription of the Spink5 gene generates two Spink5 transcripts (3394 bp and 4765 bp) with different 3’-untranslated regions (UTRs) that encode the same 1017 aa protein (1)Vega and Ensembl list a 4785 bp transcript as protein-coding. Mouse Spink5 is 60% identical and 71% homologous to human Spink5 with the exception that murine Spink5 has a 70 amino acid deletion of Kazal-type domain 6 as well as the linker between domains 6 and 7 (Figure 3(1).  Spink5 does not share significant homology to the other members of the Spink family (i.e. murine Spink3 or Spink4 as well as human SPINK1SPINK2, or SPINK4(1)

 

Spink5 is a member of a family of Kazal type serine protease inhibitors.  In human tissues, the Spink family members are involved in the protection of epithelial and mucosal tissues against proteolytic degradation [reviewed in (2) and (3)].  The Spink5 transcript(s) encodes the lympho-epithelial Kazal-type-related inhibitor (LEKTI) protein (Figures 4 & 5(1;4).  The LEKTI precursor protein has 15 potential inhibitory domains (D1-D15) (13 of which have a novel protein module of a Kazal-type-derived four-cysteine residue pattern) preceded by a signal peptide (1;4-8).  These thirteen domains lack cysteines 3 and 6 of the canonical Kazal motif [C-(X)n-C-(X)7-C-(X)10-C-(X)2/3-C-(X)m-C], but they contain four conserved cysteines that form two intramolecular disulfide bonds (1;5;6).  The other two domains, D2 and D15, contain the two additional cysteines of the typical Kazal-type proteinase inhibitor domains (5;9).  The LETKI Kazal-type domain sequences form hairpin structures to create an inhibitory binding loop (7). The mouse hydrophobic Kazal-type domains are encoded by 128 bp exons; the spacers are encoded by exons of variable sizes (1) that contain many charged residues making them more susceptible to proteases (7;10).

 

The LEKTI precursor protein undergoes post-endoplasmic reticulum (ER) endoproteolytic cleavage (4;9;11). Several subtilisin-like proprotein convertase (SPC) consensus sequences are found within full-length LEKTI, indicating that LEKTI may be cleaved by SPCs to generate at least fourteen polypeptides (9). Furin, an SPC expressed in the epidermis, is thought to be essential for LEKTI peptide processing because LEKTI processing can be prevented by the application of a furin inhibitor (4;7;9;11-13).  Although LEKTI can potentially generate fourteen polypeptides from the precursor, the detection of only three of these polypeptide fragments indicates that not all of these sites are utilized in vivo (9). The extent of the processing as well as the activity of the processed peptides is yet to be determined (12)

 

Full length recombinant LEKTI can inhibit trypsin, plasmin, subtilisin A, cathepsin G, and elastase (7;9;12).  In addition, four of the 15 inhibitory domains can inhibit members of the kallikrein (KLK) family (i.e. KLK5, KLK7, and KLK14) (7;14).  Domains D5 and D6 inhibit trypsin only, while a recombinant LEKTI that contains D6-D9 inhibits trypsin, KLK7, chymotrypsin, and subtilisin A, but not plasmin, cathepsin G, or elastase  (8;15-17).  The ability of LEKTI to inhibit several proteins reflects its diverse functions in several processes within the body including tissue homeostasis, inflammation, and antimicrobial defense (7;15;18)

 

PNGase treatment followed by Western blot analysis indicates that LEKTI is Asn (N)-linked glycosylated (1;9).  Other Kazal inhibitor family members are N-glycosylated (e.g. ovomucoids, the major proteinase inhibitor from avian egg whites) (19), but the function of this posttranslational modification has not been elucidated.  Another study showed evidence that LEKTI also undergoes O- (i.e. serine) linked glycosylation (7).  It is proposed that O-glycosylation of LEKTI prevents furin from proteolytically cleaving LEKTI at the domain-linking regions (7). Prevention of furin activity would prevent the processing of the LEKTI precursor and promote the generation of multidomain and single domain fragments (7).

Expression/Localization

LEKTI is secreted into the intercellular space in the uppermost stratum granulosum (SG) layer of the skin (4;20-22).  Northern blot and RT-PCR analyses have detected the expression of Spink5 in the thymus, vaginal epithelium, Bartholin gland, oral mucosa, tonsils, parathyroid gland, uterus, eye, and trachea (1;4;9;12;23).  Although lower levels of Spink5 were detected in the lung, kidney, and prostate in human samples (4), Spink5 was not detected in the lung and kidney of the mouse (1). Dot blot analysis of mouse RNA revealed that the strongest Spink5 expression was in the prostate and the epididymis (23)

 

In situ hybridization and immunohistochemistry of mouse and human tissues detected LEKTI in the suprabasal layers of stratified epithelia, thymic Hassall bodies (i.e. terminally differentiated epithelial cells of the medulla), esophagus, the suprabasal cells of the stratified epithelia of tongue, the differentiated epithelia of the thymus medulla, and the keratinocytes of the granular layer of the epidermis where biochemical and morphological changes occur in terminal differentiation to lead to stratum corneum (SC) formation (1;7;9;14;21;24)

 

Several of the smaller peptides generated from processing of the full-length LEKTI protein have been isolated from human blood filtrate including domains one, five, and six (4;12); domain 8 has been isolated from human epidermal keratinocytes (12).  In addition, other LEKTI proteolytic fragments have been found in human hair follicles (i.e. matrical cells of the bulb, the hair shaft cuticle, and the inner root sheath) (1;5;9).

Background

The skin is an essential organ that protects the fragile internal tissues from injury.   It is comprised of three major layers: the epidermis, dermis, and subcutaneous tissue.  The epidermis is a physical barrier that limits the loss of fluid from the body as well as an adaptive immunological barrier composed of cellular and humoral components of the immune system and a chemical barrier that consists of antimicrobial peptides, lipids, acids, hydrolytic enzymes, and macrophages that defend the host from surrounding bacteria, fungi, and other potentially toxic materials (13;25;26). The epidermis has several structurally different layers: the SC (cornified layer and most superficial), stratum lucidum (clear/translucent), SG (granular), stratum spinosum (spinous), and the stratum basal (basal/germinal and most deep).  Each layer indicates a different step in the basal cell differentiation process, terminating in cornification (i.e. the conversion of epithelium to stratified squamous) and desquamation (i.e. shedding) (13;27;28). The dermis contains the blood vessels and nerves of the skin and is the layer deep to the epidermal layer. It is comprised of collagen, elastic tissue, and reticular fibers.  The subcutaneous tissue deep to the dermis is comprised of fat and connective tissue and is important for the regulation of skin and body temperature. 

 

The primary cell type in the epidermis is keratinocytes that have proliferated from basal cells and differentiated to the terminally differentiated corneocytes that form the SC (13;15;26). The corneocytes are within a lipid-enriched extracellular matrix and are connected by corneodesmosomes (8;13;25). The SC layer regulates water release from the body, withstands mechanical forces, and prevents chemicals and microbes from penetrating the skin (25)

 

Proteases in the skin

Proteases are involved in epidermal differentiation as well as several other physiological functions including: T and B cell maturation, digestion, intercellular protein turnover, blood coagulation, the proteolytic activation of inactive precursors (e.g. enzymes and peptide hormones), and extracellular matrix remodeling [reviewed in (4;6;10)]. Proteases can be grouped in to one of several classes: serine (e.g. several allergens and digestive enzymes), threonine (e.g. the proteasome (18)), cysteine (e.g. calpains, cystatins, and cathepsins), aspartate (e.g. pepsins, renins, and cathepsins), metalloproteinase (e.g. matrix metalloproteases), or glutamate (this class is only found in fungi (29)) (4;10;18;26).


Figure 6. LEKTI regulates the process of desquamation and prevents the KLK5-mediated proinflammatory response in skin. Mutations in LEKTI results in a loss of KLK5 inhibitionLEKTI prevents the activation of PAR-2 via KLK5.  Under conditions in which LEKTI is inactive, KLK5 induces TSLP, IL8, and TNF-α overexpression through PAR2 and the NF-κB pathway.  If KLK5 is unregulated, it aslo degrades desmosomes at the interface between the GR and SC, leading to defective SC adhesion and IL-1β, IL8, and TNF-α secretion by the stressed keratinocytes. The proinflammatory mediators trigger eeosinophils and mast cell recruitment and activation.  TSLP, inaddition to stimulating the secretion of chemokines, aslo promotes the differentiation of naive T cells into Th2 cells.  Taken together, these conditions favor the development of inflammatory skin conditions such as atopic dermatitis (MIM # 605845).

 

In order for desquamation to occur, the corneodesmosomes are degraded by proteases, often from the kallikrein (KLK) subfamily of trypsin-like serine proteases (e.g. KLK5 (i.e. SC tryptic enzyme (SCTE)) and KLK7 (i.e. SC chymotryptic enzyme (SCCE)); desquamation does not cause a barrier defect (6;13;15;26;30-32).  The kallikreins are the largest family of trypsin- or chymotrypsin-like serine proteases [reviewed in (26)].  In addition to the cleavage of corneodesmosomes (33), kallikreins also facilitate the activation of protease-activated receptor (PAR)-2 (34), a receptor involved in signaling during epidermal inflammation (35) and the regulation of epidermal barrier function (36). In the first step of epidermal desquamation, pro-kallikreins are synthesized in the SG and are subsequently converted to their active forms (13). Next, to prevent the premature degradation of corneodesmosomes and premature desquamation in the granular layer and the SC, the active kallikreins form an inhibitory complex with LEKTI (7;13). The kallikreins that are not bound to LEKTI degrade corneodesmosomes and subsequent desquamation of the SC occurs [Figure 6; (13)].  

 

Additional proteases in the skin include: matriptase, prostasin, caspase 14, cathepsin C, and cathepsin D (Table 3) [reviewed in (26)].

 

Table 3.  Proteases in the skin.

Protease

Class

Function in the skin

Protease-related skin pathologies

Refs

KLK5 & KLK7

Serine (trypsin- or chymotrypsin-like family)

Cleavage of corneodesmosomes; regulates antimicrobial effects of cathelicidins (i.e. anti-microbial peptides); activates PAR-2

Rosacea; overexpression: increased epidermal thickness and inflammation

(33;34;37-42)

Matriptase (see mask, masquerade, and zorro) and Prostasin

Serine

Terminal differentiation of epidermis (desquamation and SC formation); proteolytic activation of prostasin: processes profilaggrin; barrier function

Ichthyosis (MIM #602400): hyperkeratosis

(43-45)

Caspase 14

cysteinyl aspartate

Degradation of filaggrin; formation of epidermal barrier: protects from water loss and UVB damage

Shiny and lichenified skin; reduced skin hydration

(46;47)

Cathepsin C

Cysteine

Activation of serine proteases (granzymes A and B) in immune cells; structural organization of epidermis at extremities; indirect processing of keratins

Papillon Lefevre syndrome (MIM #245000); Haim-Munk syndrome (MIM # 245010)

(48-50)

Cathepsin D

Aspartic

Desquamation

None

(51;52)

 

Protease inhibitors

Proteinase inhibitors are essential during cell differentiation, proliferation and migration (6).  Pathological conditions (e.g. skin inflammation with a concomitant increase in shedding and a thickening of the skin) can occur when proteases are generated by viruses, bacteria, and parasites as well as when proteases are not regulated by proteinase inhibitors (Table 4) (4;26). Similar to the proteases, the function of the inhibitors is limited to a specific class of protease (19).

 

Table 4.  Protease inhibitors of the skin [adapted from (26))

Inhibitor

Associated protease family

Localization and/or Function

Inhibitor-related skin pathology

Refs

LEKTI (Spink5)

Serine protease inhibitor: e.g. trypsin, plasmin, subtilisin A, cathepsin G, elastase, KLKs

Keratinocytes of the SG of the epidermis; it is delivered to the SG-SC interface

Netherton Syndrome (MIM #256500)

(4;21;53;54)

LEKTI-2 (Spink9)

Serine protease inhibitor: e.g. trypsin, plasmin, thrombin, KLK (5 not 7)

SG of palmar and plantar skin

None

(55;56))

Secretory leukocyte protease inhibitor (SLPI)/Elafin

Serine protease inhibitor

Keratinocytes; protects skin from infiltrating neutrophils; antimicrobial defense

Upregulated in inflammation

(57;58)

Serine Protease Inhibitors (SERPINs)

Subtilisin A; proteinase Kl gp41 fusion peptide in HIV-1

Protects from bacterial proteases

Squamous cell carcinoma

(59-63)

Cystatins (e.g. cystatin C, cystatin M/E

Cysteine proteases (lysosomal and microbial); regulatory and protective

Antimicrobial function; epidermal cornification

Abnormal SC and hair follicle formation; disturbance of skin barrier; neonatal death; cystatin C: cerebral amyloid angiopathy (MIM #105150) & age-related macular degeneration (MIM #611953

(64-70)

 

 

The most extensively studied class of inhibitors is the serine proteinase inhibitors. There are eleven families of serine protease inhibitors including SERPINs, Kunitz type, leuko-proteases, and Kazal type (71).  The Kazal family is expressed in all vertebrates that have been examined to date, including human, bovine, ovine, and canine (19).  In addition, they have also been extracted from nonvertebrates (i.e. leeches) (19).  The Kazal family has a characteristic inhibitory domain that contains three conserved disulfide bonds and a reactive site loop (17;72).  Each of the inhibitory domains can have specialized inhibitory functions (either individually or simultaneously) towards trypsin, chymotrypsin, elastase, and subtilisin (17;19;73).

 

LEKTI

LEKTI is proposed to be an anti-inflammatory factor (i.e. in the NF-κB-associated signaling pathway) that protects mucous epithelia (4;9;74). In addition, studies found that LEKTI has a role in the terminal differentiation of keratinocytes (by regulating the expression of keratin 10 and keratin 14 (markers of epidermal differentiation) and/or regulating profilaggrin processing (profilaggrin is an essential protein for skin development and barrier function; filaggrin is an intermediate filament that aids the packing of keratin filaments) and/or desquamation (1;7;15;75). The diverse localization of LEKTI indicates that, along with its role in desquamation, LEKTI could be involved in antimicrobial protection (indicated by LEKTI expression in tongue, vagina, and esophagus epithelia), hair growth, morphogenesis and differentiation (indicated by LEKTI expression in the hair shaft) (9;24), and in thymocyte differentiation (indicated by LEKTI expression in the thymus) (1;9).  The function of LEKTI in Hassall’s bodies is currently unknown, but its strong expression points to a role in the regulation of T cell maturation (1;9).  The localization of LEKTI in the SC also indicates that it targets SCTE and SCCE during desquamation (9;24;76;77); LEKTI and SCTE/SCCE are also colocalized in the hair follicle (9;24).  Another possible target of LEKTI is membrane-type serine protease I (MT-SP1), which would subsequently lead to the inhibition of keratinocyte differentiation through the activation of PAR-2 at the keratinocyte surface (9).

 

Extracellular and intracellular pH is essential for maintaining the activity of several proteases in the skin as well as their association with protease inhibitors (7;13).  For example, KLK5 and KLK7 are active at the neutral pH (pH 7.5) that is observed at the SG-SC interface (7).  Also, the interaction with LEKTI and KLKs in the epidermis is strong at a neutral pH (7;8;13).  Upon contact with the acidic environment of the upper SC (pH 4.5), LEKTI dissociates from the kallikreins, leading to restriction of the activity of the kallikreins and subsequently, desquamation of the uppermost layers of the SC (13;14). Taken together, acidification appears to be essential for the detachment of superficial corneocytes during desquamation (7). LEKTI is also regulated (in cultured keratinocytes) by external calcium concentrations (9).

 

LEKTI and Disease

Genetic abnormalities in Spink5 can cause atopy (MIM #147050), asthma (MIM #600807), and atopic dermatitis [Figure 6; MIM # 605845; (78-83)].  A common polymorphism in Spink5 associated with all of these diseases is a glutamic acid to lysine mutation at residue 420 (10;84).  Atopic dermatitis (AD; or eczema), a chronic inflammatory condition of the skin, affects ~10-15% of the population (84;85).  Individuals that have eczema have xerosis, itch, and erythematous lesions with increased transepidermal water loss (14).   Often, in patients that have eczema, there is a subsequent development of asthma and food allergies (14;85).  Eczema and asthma are both examples of atopic diseases (i.e. caused by an allergy) characterized by elevated levels of IgE (85).

 

One of the most extensively studied pathological conditions associated with LEKTI is Netherton Syndrome (MIM #256500). Netherton Syndrome (NS) is a condition in which the skin is chronically inflamed and undergoes scaling and/or a continuous peeling (6).  Several LEKTI mutations that cause NS have been identified including, but not limited to: a nonsense mutation (R790X), insertions (i.e. 238insG, 720insT, 2258insG, 2468insA), deletions (i.e. 153delT, 1086delAT) and splice-site mutations, all of which are predicted to form premature termination codons (6;9;12;53;74).  NS is an autosomal recessive condition that is characterized by congenital ichthyosis (i.e. dry, thickened and flaky skin) with defective cornification and keratinization, recurrent and sometimes persistent bacterial infections, dehydration, electrolyte imbalance, hypothermia, recurrent infections of the skin or respiratory tract, increased neonatal lethality, abnormal secretion of lamellar bodies, SC detachment, hair defects (i.e. ‘bamboo hair’), elevated IgE levels, food allergies, and elevated proteolytic activity in the suprabasal epidermis (1;5;6;9;12;13;15;24;53). In individuals with a severe form of the disease, the dry scaling skin can evolve into a migratory scaling and erythematous plaques (6).  Furthermore, abnormalities observed in the hair shaft can result in alopecia (6). In NS, there is abnormal maturation of T lymphocytes leading to a disruption in the regulation of Th2 response to allergens.  This disruption in Th2 function leads to acute hypersensitivity and increased IgE levels.

 

In addition to the skin-related phenotypes listed above for NS, patients can also have enteropathy (loss of protein through the intestine), hypernatremia (i.e. elevated sodium levels in the serum), hypoalbuminemia (i.e. low levels of albumin in the serum), aminoaciduria (i.e. amino acids in the urine), and developmental delay (86). In a study that examined patients with NS caused by a mutation in Spink5, NK T cells were increased while unswitched (CD19+CD27+IgM+IgD+) and switched (CD19+CD27+IgM-IgD-) memory B cells were decreased; γδ-T cells and regulatory T cells (CD4+CD25+FOXP3+) were not significantly changed from healthy controls (86).  In addition, lymphocyte proliferation to mitogens and antigens were normal and serum IgE levels were significantly elevated (86).  Proinflammatory and anti-inflammatory cytokines were increased in the serum of the patients with NS (86).  However, the chemokine (C-C motif) ligand 5 (CCL5), a chemokine that is regulated on activation and is expressed and secreted by T cells, was decreased (86). Primary and/or secondary antibody responses were decreased in patients with NS (86). The abnormal antibody responses to bacteriophage observed in the NS patients from this study suggests that abnormal T-cell or B-cell development and/or defective costimulatory signaling leads to reduced isotype switching and defective immunologic memory. Intravenous immunoglobin replacement therapy in the NS patients led to a decrease in inflammation and an increase in NK-cell cytotoxicity (86).

 

In SC collected from NS patients with LEKTI mutations, the hydrolytic activity was increased compared to controls, indicating that serine proteases were overactive (24).  Similar to the findins from several mouse models (see “LEKTI Mouse Models”, below), it is speculated that the increase in protease activity leads to an increased degradation of desmoglein-1 (DSG1) (24).  Furthermore, it was proposed that KLK5 and KLK7 are regulated by LEKTI-derived inhibitors and affect hair growth and morphogenesis (24).  Upon the loss of LEKTI-mediated inhibition in patients with NS, it is speculated that a cycle of chronic allergen-induced inflammation is induced by the expression of tryptase (9). The serine protease tryptase can mediate several allergic and inflammatory conditions through PAR-2 activation.

 

LEKTI Mouse Models

Several groups have studies the functional role of LEKTI by using mouse models.  Knockout of LEKTI found that although the skin in the homozygous embryos was not significantly different from wild-type animals at embryonic day (E) 15.5, by E17.5, there was focal detachment of granular cells and the SC began to peel off; skin-barrier formation was normal (5). Heterozygous animals were normal (5).  The loss of cell-cell adhesion, detachment of the SC, and the loss of barrier function resulted in perinatal death within hours of birth due to dehydration (5).  Examination of the SC found that there was increased proteolytic activity and a premature degradation of extracellular desmosomal components (5).  In addition, transmission electron microscopy of skin from the knockout animals demonstrated abnormal cornification (5).  Loss of LEKTI expression resulted in higher proteinase activity in the SC, upper spinous, and SG layers compared to the wild-type animal (5).  It was proposed that that the premature degradation of desmosomal components (i.e. corneodesmosin (CDSN), a protein that stabilizes the desmosome) could be caused by the increase in proteinase activity and that SCCE and SCTE cooperate with LEKTI to regulate the stability of CDSN (5).

 

A second study characterizing a LEKTI knockout found that the mice had impaired keratinization, hair malformation, defects in the skin barrier and altered desquamation (15).  Similar to the previous study, this knockout model also died within a few hours of birth due to a loss of SC adherence and epidermal fragility (15).  This study found that abnormal desmosome cleavage occurred following degradation of DSG1, a target of KLK5 and KLK7 (15).  Furthermore, this study found that profilaggrin processing was increased, revealing that LEKTI is an essential member of cornification (15).  In the LEKTI knockout mice, there was an increase in CDSN as well as a proposed abnormal proteolytic processing of CDSN (15).  Characterization of the hair follicle found that intracellular adhesion was disrupted in the inner root sheath (IRS) and the between the IRS and the hair shaft (15).

 

A third study generated a mouse model with targeted disruption of Spink5 (7).  Similar to the other knockout studies, the Spink5-null mice had disrupted desquamation and impaired keratinization, hair malformation, and skin barrier defects (7).  Similar to the findings of Descargues et al., there was abnormal desmosome cleavage due to the loss of DSG1 (7).

 

In another study, a mutant LEKTI (R820X) was generated and characterized (12).  Similar to the LEKTI knockout models, the R820X LEKTI animals lost skin barrier function, resulting in dehydration and subsequent death within a few hours after birth (12).  In this model, it was determined that there was an increased proteolytic processing of profilaggrin in the skin, leading to defects in SC adhesion and compromised epidermal barrier function (12)

Putative Mechanism

Similar to Spink5 null mice, the crusty2 mice do not thrive.   In the null mice, the loss of cell-cell adhesion, detachment of the SC, and the loss of barrier function resulted in perinatal death within hours of birth due to dehydration (5;15). In addition, the crusty2 phenotype seems to mimic human NS in that the skin of the crusty2 mice is chronically inflamed.  As listed above, there are several phenotypic characteristics of NS including dehydration, increased neonatal lethality, persistant bacterial infections, and congenital ichthyosis.  In addition, in studies on patients with NS, the levels of NK T cells as well as B cells were changed from healthy individuals (86).  Aberrant NK-cell function in NS patients was proposed to be due to a deficiency in NK cell-epithelial cell interaction (86).  

 

It is possible that the crusty2 mutation is leading to an inability of immune cells to associate with epithelial cells of the skin, leading to the observed skin phenotype.  Cathelicidins are innate antimicrobial peptides that are enzymatically processed by kallikreins from a proform to a mature peptide (e.g. LL-37 in neutrophils) (38).  Increase in the expression of cathelicidin (and the subsequent mature peptides) is induced by infection, inflammation, and differentiation by promoting leukocyte chemotaxis, angiogenesis, and the expression of extracellular matrix components (37;38). Cathelicidin peptides at the skin surface are processed by kallikreins and this processing is altered in the absence of LEKTI (which is probable in crusty2) (38).  Changes in the active form of cathelcidin in the skin would make the crusty2 mice more susceptible to microbes. Also, it is probable that there is increased proteolytic activity in the SC of the crusty2 mice as well as a premature degradation of desmosomal components (i.e. CDSN and DSG-1) as a result of the uninhibited activity of KLK5 and KLK7.

Primers Primers cannot be located by automatic search.
Genotyping

Crusty2 genotyping is performed by amplifying a region containing a mutation in Spink5 using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification of Spink5:

 

Primers for PCR amplification

CRUSTY2_Spink5_PCR_F: 5'- GCAGCACATCACAGTTTTCAAAGGGA -3'

CRUSTY2_Spink5_PCR_R: 5'- CCCAGAAAATACATCTGCCACTCTGTT -3'

 

Primers for Sequencing

CRUSTY2_Spink5_Seq_F: 5'- CATCACAGTTTTCAAAGGGAGTAAG -3'

 

 

PCR program

1) 94° C      2:00

2) 94° C      0:30

3) 57° C      0:30

4) 72° C      1:00

5) repeat steps (2-4) 29x

6) 72° C      7:00

7) 4° C         

 

The following sequence of 601 nucleotides (from Genbank genomic region: of the linear genomic sequence NC_000084.5 of Spink5) is amplified:

 

36421                                                   gcag cacatcacag    

36481 ttttcaaagg gagtaaggtg ggtgagggaa gttttgtagt gtttagtgat ctgattctca    

36541 aatccttctt catttgacag gagctctgtc gtaaatacca tacccagctc agaaatgggc    

36601 cgctccgctg caccagaagg aataacccca ttgagggcct ggatgggaag atgtataaaa    

36661 atgcctgctt catgtgttgg gccttcttgt gagtatagct gcagccatta ctgttaggtg    

36721 ttaaatgtag gggtggctta ctccagaaca ctgatgatga agcctgtctt tctttgtgct    

36781 gagtttgggg gcagggtata ttatcatcaa gccacacact gacagtactt tctactgctt    

36841 cagtgttctg aaagatgttg aaattatcac catagtagca tcatgtgcga ataccagata    

36901 tccccagagt tatgttaata actcagtttc atgactaaca caaaggtaga gtcattcaat    

36961 gataacaagt tgaaatttgt caacactaac catttttcta gttgttttct gtggaaaaaa    

37021 atataaatct tcattcatca aaacagagtg gcagatgtat tttctggg

 

PCR primer binding sites are underlined and sequencing primer binding sites are highlighted; the mutated T is highlighted in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Victoria Webster
AuthorsWataru Tomisato, Owen M. Siggs, Bruce Beutler
List |< first << previous [record 92 of 511] next >> last >|