Mutagenetix > Phenotypic Mutation

Phenotypic Mutation 'Hema6' (pdf version)

Allele

Hema6

Mutation Type

Chromosome

Coordinate

23,587,653 bp (GRCm39)

Base Change

T ⇒ C (forward strand)

Gene

Ank1

Gene Name

ankyrin 1, erythroid

Synonym(s)

Ank-1, pale

Chromosomal Location

23,464,860-23,640,513 bp (+) (GRCm39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutant animals are anemic, infertile, and have reduced body size. Mutant animals also exhibit jaundice, bone marrow hyperplasia, splenomegaly, hepatomegaly, enlarged lymph nodes, increased white blood cell count, and cardiac hypertrophy. [provided by MGI curators]

Accession Number

Ncbi Refseq:NM_001110783.2; NM_031158.3; NM_001277280.1; NM_001277281.1; NM_001277284.1; NM_001277286.1; NM_001277289.1 MGI:88024

Mapped

Yes

Limits of the Critical Region

17525050 - 30561421 bp

Amino Acid Change

Institutional Source

Beutler Lab

Gene Model

not available

AlphaFold

no structure available at present

SMART Domains

Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	15	44	2.5e3	SMART
ANK	48	77	3.26e0	SMART
ANK	81	110	3.15e-7	SMART
ANK	114	143	9.05e-8	SMART
ANK	147	175	4.67e-1	SMART
ANK	176	205	1.42e0	SMART
ANK	209	238	4.39e-6	SMART
ANK	242	271	1.33e-5	SMART
ANK	275	304	7.53e-5	SMART
ANK	308	337	2.35e-6	SMART
ANK	341	370	6.65e-6	SMART
ANK	374	403	5.2e-8	SMART
ANK	407	436	8.78e-6	SMART
ANK	440	469	7.53e-5	SMART
ANK	473	502	5.49e-7	SMART
ANK	506	535	2.58e-3	SMART
ANK	539	568	1.88e-5	SMART
ANK	572	601	1.02e-6	SMART
ANK	605	634	7.64e-6	SMART
ANK	638	669	3.23e-4	SMART
ANK	671	700	1.38e-3	SMART
ANK	704	733	1.58e-7	SMART
ANK	737	766	2.85e-5	SMART
ZU5	923	1027	1.9e-60	SMART
low complexity region	1050	1059	N/A	INTRINSIC
low complexity region	1387	1397	N/A	INTRINSIC
DEATH	1405	1499	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
ANK	44	73	2.5e3	SMART
ANK	77	106	3.26e0	SMART
ANK	110	139	3.15e-7	SMART
ANK	143	172	9.05e-8	SMART
ANK	176	204	4.67e-1	SMART
ANK	205	234	1.42e0	SMART
ANK	238	267	4.39e-6	SMART
ANK	271	300	1.33e-5	SMART
ANK	304	333	7.53e-5	SMART
ANK	337	366	2.35e-6	SMART
ANK	370	399	6.65e-6	SMART
ANK	403	432	5.2e-8	SMART
ANK	436	465	8.78e-6	SMART
ANK	469	498	7.53e-5	SMART
ANK	502	531	5.49e-7	SMART
ANK	535	564	2.58e-3	SMART
ANK	568	597	1.88e-5	SMART
ANK	601	630	1.02e-6	SMART
ANK	634	663	7.64e-6	SMART
ANK	667	698	3.23e-4	SMART
ANK	700	729	1.38e-3	SMART
ANK	733	762	1.58e-7	SMART
ANK	766	795	2.85e-5	SMART
ZU5	944	1048	1.9e-60	SMART
low complexity region	1071	1080	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
DEATH	1426	1520	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000113495
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
ANK	44	73	2.5e3	SMART
ANK	77	106	3.26e0	SMART
ANK	110	139	3.15e-7	SMART
ANK	143	172	9.05e-8	SMART
ANK	176	204	4.67e-1	SMART
ANK	205	234	1.42e0	SMART
ANK	238	267	4.39e-6	SMART
ANK	271	300	1.33e-5	SMART
ANK	304	333	7.53e-5	SMART
ANK	337	366	2.35e-6	SMART
ANK	370	399	6.65e-6	SMART
ANK	403	432	5.2e-8	SMART
ANK	436	465	8.78e-6	SMART
ANK	469	498	7.53e-5	SMART
ANK	502	531	5.49e-7	SMART
ANK	535	564	2.58e-3	SMART
ANK	568	597	1.88e-5	SMART
ANK	601	630	1.02e-6	SMART
ANK	634	663	7.64e-6	SMART
ANK	667	698	3.23e-4	SMART
ANK	700	729	1.38e-3	SMART
ANK	733	762	1.58e-7	SMART
ANK	766	795	2.85e-5	SMART
ZU5	952	1056	1.9e-60	SMART
low complexity region	1079	1088	N/A	INTRINSIC
low complexity region	1416	1426	N/A	INTRINSIC
DEATH	1434	1528	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	7	36	2.5e3	SMART
ANK	40	69	3.26e0	SMART
ANK	73	102	3.15e-7	SMART
ANK	106	135	9.05e-8	SMART
ANK	139	167	4.67e-1	SMART
ANK	168	197	1.42e0	SMART
ANK	201	230	4.39e-6	SMART
ANK	234	263	1.33e-5	SMART
ANK	267	296	7.53e-5	SMART
ANK	300	329	2.35e-6	SMART
ANK	333	362	6.65e-6	SMART
ANK	366	395	5.2e-8	SMART
ANK	399	428	8.78e-6	SMART
ANK	432	461	7.53e-5	SMART
ANK	465	494	5.49e-7	SMART
ANK	498	527	2.58e-3	SMART
ANK	531	560	1.88e-5	SMART
ANK	564	593	1.02e-6	SMART
ANK	597	626	7.64e-6	SMART
ANK	630	661	3.23e-4	SMART
ANK	663	692	1.38e-3	SMART
ANK	696	725	1.58e-7	SMART
ANK	729	758	2.85e-5	SMART
ZU5	907	1011	1.9e-60	SMART
low complexity region	1034	1043	N/A	INTRINSIC
low complexity region	1371	1381	N/A	INTRINSIC
DEATH	1389	1483	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000113531
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	7	36	2.5e3	SMART
ANK	40	69	3.26e0	SMART
ANK	73	102	3.15e-7	SMART
ANK	106	135	9.05e-8	SMART
ANK	139	167	4.67e-1	SMART
ANK	168	197	1.42e0	SMART
ANK	201	230	4.39e-6	SMART
ANK	234	263	1.33e-5	SMART
ANK	267	296	7.53e-5	SMART
ANK	300	329	2.35e-6	SMART
ANK	333	362	6.65e-6	SMART
ANK	366	395	5.2e-8	SMART
ANK	399	428	8.78e-6	SMART
ANK	432	461	7.53e-5	SMART
ANK	465	494	5.49e-7	SMART
ANK	498	527	2.58e-3	SMART
ANK	531	560	1.88e-5	SMART
ANK	564	593	1.02e-6	SMART
ANK	597	626	7.64e-6	SMART
ANK	630	661	3.23e-4	SMART
ANK	663	692	1.38e-3	SMART
ANK	696	725	1.58e-7	SMART
ANK	729	758	2.85e-5	SMART
ZU5	907	1011	1.9e-60	SMART
low complexity region	1034	1043	N/A	INTRINSIC
low complexity region	1371	1381	N/A	INTRINSIC
DEATH	1389	1483	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	15	44	2.5e3	SMART
ANK	48	77	3.26e0	SMART
ANK	81	110	3.15e-7	SMART
ANK	114	143	9.05e-8	SMART
ANK	147	175	4.67e-1	SMART
ANK	176	205	1.42e0	SMART
ANK	209	238	4.39e-6	SMART
ANK	242	271	1.33e-5	SMART
ANK	275	304	7.53e-5	SMART
ANK	308	337	2.35e-6	SMART
ANK	341	370	6.65e-6	SMART
ANK	374	403	5.2e-8	SMART
ANK	407	436	8.78e-6	SMART
ANK	440	469	7.53e-5	SMART
ANK	473	502	5.49e-7	SMART
ANK	506	535	2.58e-3	SMART
ANK	539	568	1.88e-5	SMART
ANK	572	601	1.02e-6	SMART
ANK	605	634	7.64e-6	SMART
ANK	638	669	3.23e-4	SMART
ANK	671	700	1.38e-3	SMART
ANK	704	733	1.58e-7	SMART
ANK	737	766	2.85e-5	SMART
ZU5	923	1027	1.9e-60	SMART
low complexity region	1050	1059	N/A	INTRINSIC
low complexity region	1387	1397	N/A	INTRINSIC
DEATH	1405	1499	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
ANK	44	73	2.5e3	SMART
ANK	77	106	3.26e0	SMART
ANK	110	139	3.15e-7	SMART
ANK	143	172	9.05e-8	SMART
ANK	176	204	4.67e-1	SMART
ANK	205	234	1.42e0	SMART
ANK	238	267	4.39e-6	SMART
ANK	271	300	1.33e-5	SMART
ANK	304	333	7.53e-5	SMART
ANK	337	366	2.35e-6	SMART
ANK	370	399	6.65e-6	SMART
ANK	403	432	5.2e-8	SMART
ANK	436	465	8.78e-6	SMART
ANK	469	498	7.53e-5	SMART
ANK	502	531	5.49e-7	SMART
ANK	535	564	2.58e-3	SMART
ANK	568	597	1.88e-5	SMART
ANK	601	630	1.02e-6	SMART
ANK	634	663	7.64e-6	SMART
ANK	667	698	3.23e-4	SMART
ANK	700	729	1.38e-3	SMART
ANK	733	762	1.58e-7	SMART
ANK	766	795	2.85e-5	SMART
ZU5	952	1056	1.9e-60	SMART
low complexity region	1079	1088	N/A	INTRINSIC
low complexity region	1416	1426	N/A	INTRINSIC
DEATH	1434	1528	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	15	44	2.5e3	SMART
ANK	48	77	3.26e0	SMART
ANK	81	110	3.15e-7	SMART
ANK	114	143	9.05e-8	SMART
ANK	147	175	4.67e-1	SMART
ANK	176	205	1.42e0	SMART
ANK	209	238	4.39e-6	SMART
ANK	242	271	1.33e-5	SMART
ANK	275	304	7.53e-5	SMART
ANK	308	337	2.35e-6	SMART
ANK	341	370	6.65e-6	SMART
ANK	374	403	5.2e-8	SMART
ANK	407	436	8.78e-6	SMART
ANK	440	469	7.53e-5	SMART
ANK	473	502	5.49e-7	SMART
ANK	506	535	2.58e-3	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	7	36	2.5e3	SMART
ANK	40	69	3.26e0	SMART
ANK	73	102	3.15e-7	SMART
ANK	106	135	9.05e-8	SMART
ANK	139	167	4.67e-1	SMART
ANK	168	197	1.42e0	SMART
ANK	201	230	4.39e-6	SMART
ANK	234	263	1.33e-5	SMART
ANK	267	296	7.53e-5	SMART
ANK	300	329	2.35e-6	SMART
ANK	333	362	6.65e-6	SMART
ANK	366	395	5.2e-8	SMART
ANK	399	428	8.78e-6	SMART
ANK	432	461	7.53e-5	SMART
ANK	465	494	5.49e-7	SMART
ANK	498	527	2.58e-3	SMART
ANK	531	560	1.88e-5	SMART
ANK	564	593	1.02e-6	SMART
ANK	597	626	7.64e-6	SMART
ANK	630	661	3.23e-4	SMART
ANK	663	692	1.38e-3	SMART
ANK	696	725	1.58e-7	SMART
ANK	729	758	2.85e-5	SMART
ZU5	907	1011	1.9e-60	SMART
low complexity region	1034	1043	N/A	INTRINSIC
low complexity region	1371	1381	N/A	INTRINSIC
DEATH	1389	1483	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000116533
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	1	29	4.82e-3	SMART
ANK	33	62	7.53e-5	SMART
ANK	66	95	5.49e-7	SMART
ANK	99	128	2.58e-3	SMART
ANK	132	161	1.88e-5	SMART
ANK	165	194	1.02e-6	SMART
ANK	198	227	7.64e-6	SMART
ANK	231	262	3.23e-4	SMART
ANK	264	293	1.38e-3	SMART
ANK	297	326	1.58e-7	SMART
ANK	330	359	2.85e-5	SMART
ZU5	508	612	1.9e-60	SMART
low complexity region	635	644	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
DEATH	990	1090	4.31e-18	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	15	44	2.5e3	SMART
ANK	48	77	3.26e0	SMART
ANK	81	110	3.15e-7	SMART
ANK	114	143	9.05e-8	SMART
ANK	147	175	4.67e-1	SMART
ANK	176	205	1.42e0	SMART
ANK	209	238	4.39e-6	SMART
ANK	242	271	1.33e-5	SMART
ANK	275	304	7.53e-5	SMART
ANK	308	337	2.35e-6	SMART
ANK	341	370	6.65e-6	SMART
ANK	374	403	5.2e-8	SMART
ANK	407	436	8.78e-6	SMART
ANK	440	469	7.53e-5	SMART
ANK	473	502	5.49e-7	SMART
ANK	506	535	2.58e-3	SMART
ANK	539	568	1.88e-5	SMART
ANK	572	601	1.02e-6	SMART
ANK	605	634	7.64e-6	SMART
ANK	638	669	3.23e-4	SMART
ANK	671	700	1.38e-3	SMART
ANK	704	733	1.58e-7	SMART
ANK	737	766	2.85e-5	SMART
ZU5	923	1027	1.9e-60	SMART
low complexity region	1050	1059	N/A	INTRINSIC
low complexity region	1387	1397	N/A	INTRINSIC
DEATH	1405	1499	3.21e-26	SMART

Predicted Effect

probably benign

SMART Domains

Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543

Domain	Start	End	E-Value	Type
ANK	15	44	2.5e3	SMART
ANK	48	77	3.26e0	SMART
ANK	81	110	3.15e-7	SMART
ANK	114	143	9.05e-8	SMART
ANK	147	175	4.67e-1	SMART
ANK	176	205	1.42e0	SMART
ANK	209	238	4.39e-6	SMART
ANK	242	271	1.33e-5	SMART
ANK	275	304	7.53e-5	SMART
ANK	308	337	2.35e-6	SMART
ANK	341	370	6.65e-6	SMART
ANK	374	403	5.2e-8	SMART
ANK	407	436	8.78e-6	SMART
ANK	440	469	7.53e-5	SMART
ANK	473	502	5.49e-7	SMART
ANK	506	535	2.58e-3	SMART
ANK	539	568	1.88e-5	SMART
ANK	572	601	1.02e-6	SMART
ANK	605	634	7.64e-6	SMART
ANK	638	669	3.23e-4	SMART
ANK	671	700	1.38e-3	SMART
ANK	704	733	1.58e-7	SMART
ANK	737	766	2.85e-5	SMART
ZU5	923	1027	1.9e-60	SMART

Predicted Effect

probably benign

Meta Mutation Damage Score

Not available question?

Is this an essential gene?

Possibly nonessential (E-score: 0.349) question?

Phenotypic Category

Autosomal Dominant

Candidate Explorer Status

loading ...

Single pedigree
Linkage Analysis Data

Penetrance

100%

Alleles Listed at MGI

All alleles(7) : Targeted(2) Spontaneous(2) Chemically induced(3)

Lab Alleles

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Ank1	APN	8	23631660	missense	probably damaging	1.00
IGL01099:Ank1	APN	8	23598265	missense	probably damaging	0.97
IGL01586:Ank1	APN	8	23610928	missense	probably benign
IGL01866:Ank1	APN	8	23583871	missense	possibly damaging	0.88
IGL01977:Ank1	APN	8	23605449	missense	probably benign	0.01
IGL02109:Ank1	APN	8	23586200	missense	probably damaging	1.00
IGL02182:Ank1	APN	8	23603868	missense	possibly damaging	0.89
IGL02261:Ank1	APN	8	23578015	missense	probably damaging	1.00
IGL02283:Ank1	APN	8	23609450	critical splice donor site	probably null
IGL02335:Ank1	APN	8	23625654	missense	possibly damaging	0.86
IGL02933:Ank1	APN	8	23612881	missense	possibly damaging	0.52
IGL03056:Ank1	APN	8	23631195	missense	probably damaging	1.00
IGL03089:Ank1	APN	8	23594848	missense	probably benign	0.00
IGL03257:Ank1	APN	8	23612914	missense	probably damaging	1.00
IGL03389:Ank1	APN	8	23578076	critical splice donor site	probably null
BB006:Ank1	UTSW	8	23606123	missense	probably damaging	1.00
BB016:Ank1	UTSW	8	23606123	missense	probably damaging	1.00
R0030:Ank1	UTSW	8	23583909	missense	probably damaging	1.00
R0077:Ank1	UTSW	8	23630183	missense	probably damaging	1.00
R0081:Ank1	UTSW	8	23606258	missense	possibly damaging	0.95
R0147:Ank1	UTSW	8	23613993	missense	probably damaging	1.00
R0148:Ank1	UTSW	8	23613993	missense	probably damaging	1.00
R0200:Ank1	UTSW	8	23586828	missense	probably damaging	1.00
R0270:Ank1	UTSW	8	23578941	splice site	probably benign
R0309:Ank1	UTSW	8	23594825	missense	probably damaging	1.00
R0490:Ank1	UTSW	8	23597890	splice site	probably benign
R0675:Ank1	UTSW	8	23600400	splice site	probably benign
R0738:Ank1	UTSW	8	23604130	missense	probably damaging	0.98
R1051:Ank1	UTSW	8	23583956	missense	probably damaging	1.00
R1239:Ank1	UTSW	8	23586171	missense	probably damaging	1.00
R1265:Ank1	UTSW	8	23607053	missense	possibly damaging	0.64
R1367:Ank1	UTSW	8	23601819	splice site	probably benign
R1413:Ank1	UTSW	8	23609393	missense	probably damaging	1.00
R1539:Ank1	UTSW	8	23583935	missense	probably damaging	1.00
R1682:Ank1	UTSW	8	23599343	missense	probably damaging	1.00
R1732:Ank1	UTSW	8	23601479	splice site	probably benign
R1911:Ank1	UTSW	8	23589666	missense	probably damaging	1.00
R2087:Ank1	UTSW	8	23583827	missense	probably damaging	1.00
R2184:Ank1	UTSW	8	23599270	missense	probably damaging	0.98
R2302:Ank1	UTSW	8	23609415	missense	probably damaging	1.00
R2356:Ank1	UTSW	8	23575688	missense	probably damaging	1.00
R2495:Ank1	UTSW	8	23622280	missense	probably damaging	1.00
R3000:Ank1	UTSW	8	23609447	missense	probably damaging	1.00
R3113:Ank1	UTSW	8	23574813	missense	probably damaging	1.00
R3710:Ank1	UTSW	8	23577095	missense	probably damaging	1.00
R3768:Ank1	UTSW	8	23606202	missense	possibly damaging	0.92
R3771:Ank1	UTSW	8	23613913	missense	probably benign	0.03
R4002:Ank1	UTSW	8	23629479	missense	probably damaging	0.98
R4478:Ank1	UTSW	8	23610594	missense	probably benign	0.30
R4755:Ank1	UTSW	8	23594990	missense	probably damaging	1.00
R4756:Ank1	UTSW	8	23612893	missense	probably benign
R4979:Ank1	UTSW	8	23622212	missense	probably damaging	0.98
R4989:Ank1	UTSW	8	23631134	intron	probably benign
R5011:Ank1	UTSW	8	23572300	missense	probably damaging	1.00
R5013:Ank1	UTSW	8	23572300	missense	probably damaging	1.00
R5031:Ank1	UTSW	8	23589696	missense	probably damaging	1.00
R5051:Ank1	UTSW	8	23609397	missense	probably damaging	1.00
R5059:Ank1	UTSW	8	23586204	missense	probably damaging	0.99
R5086:Ank1	UTSW	8	23578634	missense	probably damaging	1.00
R5108:Ank1	UTSW	8	23622571	missense	probably benign	0.11
R5235:Ank1	UTSW	8	23572212	missense	probably damaging	1.00
R5300:Ank1	UTSW	8	23622517	missense	probably benign	0.00
R5408:Ank1	UTSW	8	23572209	missense	probably damaging	1.00
R5537:Ank1	UTSW	8	23604892	missense	probably damaging	1.00
R5728:Ank1	UTSW	8	23612783	critical splice acceptor site	probably null
R5746:Ank1	UTSW	8	23606612	missense	probably damaging	1.00
R5837:Ank1	UTSW	8	23594806	missense	probably damaging	0.99
R5907:Ank1	UTSW	8	23630220	missense	probably damaging	1.00
R5997:Ank1	UTSW	8	23589678	missense	probably damaging	1.00
R6005:Ank1	UTSW	8	23622218	missense	probably damaging	1.00
R6046:Ank1	UTSW	8	23606114	missense	probably damaging	1.00
R6103:Ank1	UTSW	8	23603999	missense	probably damaging	1.00
R6268:Ank1	UTSW	8	23599687	missense	probably damaging	1.00
R6430:Ank1	UTSW	8	23622125	missense	probably damaging	1.00
R6457:Ank1	UTSW	8	23577983	missense	probably damaging	1.00
R6626:Ank1	UTSW	8	23465207	missense	probably damaging	0.98
R6935:Ank1	UTSW	8	23598247	missense	probably damaging	1.00
R7091:Ank1	UTSW	8	23548679	missense	probably benign
R7162:Ank1	UTSW	8	23622370	missense	possibly damaging	0.94
R7475:Ank1	UTSW	8	23622646	missense	probably benign
R7546:Ank1	UTSW	8	23555011	missense	probably damaging	1.00
R7678:Ank1	UTSW	8	23607074	missense	probably damaging	0.98
R7768:Ank1	UTSW	8	23588013	missense	probably benign	0.01
R7779:Ank1	UTSW	8	23586763	critical splice acceptor site	probably null
R7864:Ank1	UTSW	8	23577976	missense	probably damaging	1.00
R7929:Ank1	UTSW	8	23606123	missense	probably damaging	1.00
R7982:Ank1	UTSW	8	23609397	missense	probably damaging	1.00
R7984:Ank1	UTSW	8	23578982	missense	probably damaging	1.00
R8273:Ank1	UTSW	8	23575668	missense	probably damaging	1.00
R8318:Ank1	UTSW	8	23605567	missense	probably damaging	0.99
R8349:Ank1	UTSW	8	23629302	missense	possibly damaging	0.66
R8449:Ank1	UTSW	8	23629302	missense	possibly damaging	0.66
R8459:Ank1	UTSW	8	23605528	missense	probably damaging	1.00
R8506:Ank1	UTSW	8	23586851	missense	probably damaging	1.00
R8889:Ank1	UTSW	8	23606990	missense	probably damaging	1.00
R8893:Ank1	UTSW	8	23598241	missense	probably damaging	1.00
R8924:Ank1	UTSW	8	23589011	missense	probably benign	0.00
R8993:Ank1	UTSW	8	23588955	missense	probably damaging	1.00
R9016:Ank1	UTSW	8	23606264	missense	probably null	0.99
R9017:Ank1	UTSW	8	23606264	missense	probably null	0.99
R9018:Ank1	UTSW	8	23606264	missense	probably null	0.99
R9086:Ank1	UTSW	8	23589636	missense	probably damaging	0.96
R9154:Ank1	UTSW	8	23605387	missense	probably damaging	0.96
R9194:Ank1	UTSW	8	23606255	missense	possibly damaging	0.64
R9347:Ank1	UTSW	8	23607076	missense	possibly damaging	0.65
R9419:Ank1	UTSW	8	23574825	missense	probably damaging	1.00
R9452:Ank1	UTSW	8	23622429	missense	probably benign	0.00
R9568:Ank1	UTSW	8	23609381	missense	probably benign
R9689:Ank1	UTSW	8	23631253	missense	probably benign
R9747:Ank1	UTSW	8	23576993	missense	probably damaging	0.97
RF024:Ank1	UTSW	8	23609360	missense	probably benign	0.37
X0066:Ank1	UTSW	8	23631600	splice site	probably null

Mode of Inheritance

Autosomal Dominant

Local Stock

Sperm

MMRRC Submission

037103-MU

Last Updated

2021-11-17 4:37 PM by Diantha La Vine

Record Created

2011-08-22 10:19 AM by Xin Du

Record Posted

2014-04-15

Phenotypic Description

Figure 1. Hematological phenotypes of Hema6 mice. (A) RBCs exhibit spherocytosis when examined by Wright-Giemsa staining of blood smears. Image was taken at 40× magnification. (B) SEM highlighted the morphologic changes in the erythrocytes from Hema6 mice. (C) Serum erythropoietin level. (D) Reticulocytes count. (E) Serum bilirubin level. (F) Shortened erythrocyte life span in Hema6 mice. RBCs were labeled with biotin in vivo by injecting mice with biotinylation reagent N-hydroxysuccinimide-biotin at 6 wk of age. The survival of RBCs was followed by measurement of the percentage of labeled erythrocytes by FACS. In (C−F), measurements were done in mice at 8 wk of age, n = 3 for wild-type C57BL/6J control, n = 4 for Hema6 homozygotes, data are expressed as mean ± SD. Asterisks denote the level of statistical significance (two-tailed Student’s t-test) between Hema6 (−/−) and C57BL/6J mice. *P < 0.05; **P < 0.01; ***P < 0.001. To show the maximum difference between wild-type and Hema6 mice, data on heterozygotes are not shown. (G) Splenic histology from C57BL/6J and Hema6 homozygous mice. Spleens were isolated from wild-type or Hema6 homozygotes and stained for hematoxylin and eosin. (H) High levels of iron deposition in Hema6 (−/−) mice, assessed by Prussian blue staining of spleen sections. Hema6 mice have much more iron-positive cells (blue straining) relative to C57BL/6J controls. In both G and H, sections are shown at 10× magnification. Figure obtained from (2).

Figure 2. Increased osmotic fragility of Hema6 RBCs. A total of 1 μL of fresh blood was added to 0.2 mL of a series of hypotonic solutions with NaCl content ranging from 0.3% to 0.9%. The degree of lysis in 0.3% of NaCl is considered to be 100% and 0% for 0.9% of NaCl. N = 3 for both wild-type and Hema6 heterozygous mice and n = 4 for homozygous Hema6 mice; data were expressed as mean ± SD. Asterisks denote the level of statistical significance (Student’s t-test) between Hema6 (−/−) and C57BL/6J mice (in red), or Hema6 (+/−) and C57BL/6J mice (in blue). *P < 0.05; ***P < 0.001. Figure obtained from (2).

Figure 3. Hemolytic anemia was exacerbated in homozygous Hema6 mice at older ages. Red cell indices were analyzed on the same mouse at 6-weeks and 7-months old of age, respectively, for both C57BL/6J and Hema6 homozygotes. n=3 for both groups, and data was expressed as mean ± SD. Figure obtained from (2).

Figure 4. The Ank1^Hema6 mutation causes decreased ankyrin-1 protein expression on the RBC membrane skeleton. (A) Wild-type Ank1 mRNA level was reduced in Hema6 mice. Total RNA was isolated from bone marrow in both heterozygous and homozygous Hema6 mice, as well as sex- and age-matched wild-type C57BL/6J control mice. Ank1 expression was assessed by quantitative RT-PCR with GAPDH transcript as endogenous control. N = 4 for all groups of mice. Data are expressed as mean ± SD (B) Coomassie blue-stained SDS-PAGE of ghost membrane proteins. (C) Immunoblot of ghost membrane proteins with antibodies against ankyrin-1 and β-actin, respectively (top). The protein levels of ankyrin-1 were quantitated by densitometry (bottom). Result shown here represents three independent experiments, and data are expressed as mean ± SD, n = 3 for all groups. *P <0.05, **P <0.01, ***P <0.001. Figure obtained from (2).

Hema6 was identified in N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice screened for abnormal red blood cell (RBC) production and survival (1); RBCs from the index Hema6 mouse had reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin, but were increased in number compared to wild type RBCs (2). Examination of RBC indices of wild-type, heterozygous, and homozygous Hema6 mice determined that the Hema6 phenotype is dominant. Peripheral blood smears from homozygous Hema6 mice showed microcytosis and spherocytosis of RBCs [Figure 1A; (2)]. Scanning electron microscopy revealed stomatocytes and spherocytes among erythrocytes from homozygote Hema6 mice, as well as morphologic changes including membrane blebbing (Figure 1B). Serum erythropoietin levels measured by ELISA were slightly elevated in homozygous Hema6 mice at 8 weeks compared to the wild-type control (Figure 1C); mild reticulocytosis was observed in homozygous Hema6 mice (Figure 1D). RBCs from Hema6 homozygous and heterozygous mice exhibited increased hemolysis, indicated by increased total bilirubin concentration in the serum (Figure 1E). The half-life of the RBCs in the homozygous Hema6 mice was approximately 18 days compared with 28 days in the wild-type controls as measured by following the percentage of biotinylated RBCs over time (Figure 1F). The spleens from Hema6 homozygous mice were enlarged compared to the wild-type controls, and histological examination showed effacement of splenic architecture, indicating extramedullary erythropoiesis (Figure 1G). In addition, homozygous animals had increased sequestration and destruction of abnormal RBCs as indicated by excessive iron deposits in the spleen (Figure 1H). The RBCs from Hema6 heterozygous and homozygous mice exhibited increased osmotic fragility compared to those in wild-type mice [Figure 2; (2)]. Some Hema6 homozygous mice exhibited an anemia that worsened with age; a reduction in RBC number and hemoglobin level was apparent at 7 months of age [Figure 3; (2)].

Quantification of wild type Ank1 mRNA levels in erythroid progenitors from bone marrow showed a reduction in both heterozygous and homozygous Hema6 mice compared to wild-type [Figure 4A; (2)]. Examination of the proteins in RBC ghost membranes by SDS-PAGE and Coomassie blue staining found that the overall staining pattern and relative intensity of membrane and skeleton protein bands was identical between wild-type and Hema6 mice (Figure 4B). Quantification of wild type Ank1 protein levels in the Hema6 heterozygote and homozygote ghosts determined that Ank1 was reduced to 81% and 70% of wild type levels, respectively (Figure 4C).

Nature of Mutation

Figure 5. Genetic mapping and positional cloning of phenotypic mutation in Hema6 mice. (A) Genetic linkage on chromosome 8 was established by whole-genome SNPs analysis using 27 mice (13 anemic, 14 nonanemic mice). (B) Results of genotyping individual mice for the C57BL/ 6J and C57BL/10J alleles of the markers on chromosome 8. The number under each column represents the number of F2 mice with the indicated genotypes. The critical region was refined to 13 Mb, between markers B10HEMA60006 and B10HEMA60009. (C) A single nucleotide transition (T>C) was detected in the intron 13 of Ank1 gene. Figure obtained from (2).

The Hema6 mutation was mapped by bulk segregation analysis (BSA) of F2 intercross offspring using C57BL/10J as the mapping strain (n=13 with the mutant phenotype (i.e., anemia), n=14 with the normal phenotype). The mutation showed linkage on chromosome 8 (Figure 5A); genotyping of individual mice at additional markers on chromosome 8 confined the critical region containing the Hema6 locus to a 13 Mb interval containing 139 annotated genes (NCBI m37) [Figure 5B; (2)]. Within the critical region, the candidate gene Ank1 was identified. Direct sequencing of Ank1 in the index Hema6 mouse identified a T to C transition at position 23,097,638 bp (GRCm38) on chromosome 8 corresponding to base pair 122,756 of the genomic DNA sequence of Ank1 [NC_000074; Figure 5C; (2)]. The Hema6 mutation is within intron 13, 791 nucleotides from exon 13 and 209 nucleotides from exon 14 (of 44 total exons). Whole-exome HiSeq sequencing of a Hema6 homozygote mouse was also carried out to confirm the mutation: 74% of exonic sequences genome wide were covered at ≥ 4X coverage (2). The homozygous T to C transition in intron 13 of Ank1 was confirmed with 15 high-quality sequencing reads. No other homozygous mutations were detected in exonic sequences within the critical region. Genotpying of 60 mice (22 homozygotes, 31 heterozygotes, and 7 wild-types) confirmed the concordance between the Hema6 genotypes and the phenotypes (2).

<--exon 13 <--intron 13--> exon 14-->

1487 ...CCAACGCCAAGGCCAAGgtgagct...gcaataacc...ggcccagGATGACCAGACACCGCTT...
 496 ...A--N--A--K--A--K-                             -D--D--Q--T--P--L-...

FIgure 6. Splicing analyses of Ank1^Hema6 mRNA transcript. (A) Reverse transcription of Ank1 mRNA in erythroid progenitors from bone marrow in wild-type and homozygous Hema6 mice. A forward primer located in Ank1 exon 13 and a reverse primer in exon 14 were used. The transcript structure corresponding to the amplified fragment is shown on the right. (B) Schematic illustration of the splice isoforms resulting from the mutated Ank1^Hema6allele. Original exons 13 and 14 are represented by open frame, whereas cryptic exons are shaded in grey (not at scale). The mutated nucleotide residing in the middle of intron 13 is highlight in yellow and shown in bold red font. All 5′ and 3′ splice sites that were activated and used to generate different splicing forms within intron 13 are shown along the line, and the in-frame premature stop codon is indicated in italic red fonts. The sizes of removed introns and cryptic exons in 2 splice isoforms are annotated in the figure. Figure obtained from (2).

The mutated nucleotide is indicated in red; the splice donor and acceptor sites are shown in blue.

To determine if the Hema6 mutation results in the creation of a cryptic splice site, RT-PCR was carried out using primers in exons 13 and 14 (2). In contrast to the single 400 base pair band detected in the wild-type sample, three cDNA fragments were detected in the Hema6 homozygotes: the most abundant fragment corresponded to the size of wild-type Ank1 transcript, two additional low abundance fragments were observed at a higher molecular weight (Figure 6A). An in vitro splicing assay with a minigene containing Ank1 sequences spanning exons 11-16 confirmed that the Hema6 mutation results in production of two alternatively spliced isoforms in addition to the wild type transcript (2). The long splicing isoform contained a 317 base pair cryptic exon inserted as a result of the use of a preexisting cryptic 3’ splice site that is 108 base pair upstream from the Hema6 mutation. The short splicing isoform incorporated two cryptic exons (122 bp and 95 bp) as a result of the use of the aforementioned 3’ splice site as well as two preexisting cryptic 5’ and 3’ splice sites downstream of the Hema6 mutation [Figure 6B; (2)]. Both mutant transcripts introduced eight aberrant amino acids followed by an in-frame stop codon after residue 501 of ankyrin 1; the full-length aberrant mRNAs were not detected in Hema6 homozygous mice, indicating nonsense-mediated decay of the mutant transcripts occurred (2).

Illustration of Mutations in
Gene & Protein

Protein Prediction

Ank1 encodes ankyrin 1 (Ank1), a member of the ankyrin family of proteins that function to link integral membrane proteins to cytoplasmic proteins, subsequently segregating membrane proteins within functional domains on the plasma membrane [(3;4); reviewed in (5;6)]. The Ank1 protein is highly conserved from mouse to human with the sequences sharing 91% amino acid identity (7). Comparison of mouse and human Ank1 protein sequences revealed that within the band-3 and spectrin-binding domains, the sequences share >95% amino acid identity (7).

Figure 8. Crystal structure of twelve ankyrin repeats of human Ank1. Modeled after PDB: 1N11; (15). See text for details. Model generated with the PyMOL Molecular Graphics System, Schrodinger, LLC.

All of the ankyrin proteins identified to date (i.e., Ank1, Ank2, and Ank3) have two highly conserved domains: the N-terminal ankyrin repeat domain (ARD; also called membrane-binding domain) and a variable C-terminal regulatory domain [(8;9); Figure 7]. The N-terminal ARD of Ank1 [89 kDa; alternatively called the band-3 binding domain; aa 40-791 (UniProt)] is comprised of 23-24 homologous 33-amino acid ankyrin repeats (UniProt) and functions to bind integral membrane proteins: the transmembrane anion exchanger band-3 [AE1; interacts with aa 403-779 of Ank1; (10;11)], tubulin, the adhesion molecule CD44 [binds aa 218-381 of Ank1; (12;13)], and Tiam1 (14). The ARD has been organized into four folding subdomains, each with six ankyrin repeats (12;14). While early reports proposed that the ARD was packed into a spherical structure (10), the crystal structure of 12 ankyrin repeats (repeats 13-24) and a portion of the spectrin-binding domain from human ankyrin (crystal includes residues 402-827 of Ank1) showed the ARD in a spiral stack in the form of a contiguous, left-handed superhelix [PDB: 1N11; Figure 8; (15)]. Individual ankyrin repeats are L-shaped and consist of two α-helices and a long loop; the ankyrin repeats are linked by a β-hairpin (15). The α-helices of adjacent ankyrin repeats form a four-helical bundle; the long loop covers one end of the bundle, while the β-hairpin extends away from the bundle (15). Each repeat in the crystal structure is twisted 2-3° relative to the preceding repeat (15). Michaely et al. modeled the entire set of 24 repeats by extending the solved ankyrin repeat 13-24 superhelix and retaining the determined 13° pitch (15). The modeled full repeat stack forms a superhelical spiral with a radius of 45Å and an axial length of 132Å (15). The concave ankyrin groove surface of repeats 20-24 associates with the first 11 residues of the spectrin-binding domain, which is antiparallel to the repeat stack (15). Van der Waals contacts involving His802, Met804, Pro807, and Val810 and polar interactions involving Ser805, Glu808, and Asp811 mediate this association (15). Ser805 forms main chain and side chain hydrogen bonds with Tyr702, Gln740, and Gln743 on the repeat stack (15). Non-ankyrin ARD-containing proteins have a variety of functions but many facilitate protein-protein interactions and some participate in protein-DNA interactions (16;17).

The 62 kDa central spectrin-binding domain of Ank1 (aa 828-1386 in human ANK1) shares approximately 97% amino acid identity between mouse and human sequences (7). This domain contains a ZO-1 and Unc5-like netrin receptor (ZU5) subdomain (aa 952-1056; SMART), a motif that directly binds β-spectrin (9). At the junction of the spectrin-binding domain and the ARD, Ank1 interacts with a 25-amino acid C-terminal sequence of the α₁-Na⁺, K⁺-ATPase to facilitate the transport of α₁-Na⁺, K⁺-ATPase from the endoplasmic reticulum to the Golgi (18-22).

The acidic 55 kDa C-terminal regulatory domain differs in length and amino acid composition in the different isoforms of Ank1 (see below for more details on the multiple isoforms of Ank1) and has lower homology between mouse and human sequences (79% amino acid identity) than the band-3- and spectrin-binding domains (23). The regulatory domain functions to modify the binding activities of the other two domains (4;24;25). Alternative splicing of the C-terminal regulatory domain due to the use of an alternative splice acceptor site in exon 38 deletes a center portion of the regulatory domain (i.e., aa 1513-1674 (26)) to generate isoform 2.2 (ENSMUST00000110688) and leads to increased affinity for both β-spectrin and band 3 (7;23-28). A death domain is within the C-terminal regulatory domain (aa 1434-1528; SMART); the Ank1-associated function of this motif is unknown (29;30).

The Ank1 gene generates multiple, cell-type and stage-specific transcripts as a result of alternative splicing of the C-terminal regulatory domain, multiple sites of polyadenylation, and multiple promoters (4;23;27;31-33). Alternative splicing within the regulatory domain generates an isoform with increased affinity for spectrin and band 3, as mentioned above. Alternative splicing also gives rise to several isoforms that have different C-termini (8;23;24;27). One such isoform has an acidic C-terminus of 33 amino acids, another has a basic 32 amino acid C-terminus, and the third has a neutral C-terminus (27). The function of these isoforms is unknown.

The Hema6 mutation is within intron 13 of Ank1, causing incomplete alternative splicing of the transcript. The Hema6 mutation results in two aberrantly spliced transcripts as a result of the utilization of cryptic splice sites in intron 13 [Figure 6; (2)]. Both of the transcripts are predicted to encode 55-kDa cytosolic proteins that lack one-third of the ARD, the spectrin-binding domain, and the C-terminal regulatory domain. However, full-length aberrant mRNA was not detected, indicating that nonsense-mediated decay of the mutant transcripts occurs. The Hema6 mutant produces reduced levels of wild-type Ank1 protein.

Expression/Localization

Northern blot analysis detected Ank1 expression in erythroid tissue, brain (i.e., cerebellum), skeletal muscle, heart, bone marrow, and spleen [(8;23;24;27;34); reviewed in (6)]. 9.0- and 7.5-kb Ank1 transcripts are expressed in erythrocytes: the 9.0-kb transcript is predominant in early erythroid differentiation, while the 7.5-kb transcript is predominant in reticulocytes (8;24;35). The cerebellum primarily expresses a 9.0-kb transcript, while the spleen and bone marrow express the 7.5- and 9.0-kb transcripts at a ratio of ~2:1 (36). The anemic (erythrogenic) spleen expresses 9.0-, 7.5-, 3.5-, and 2.0-kb transcripts [(23;24;35); reviewed in (6)]. The spleen also expresses a unique 5.0-kb Ank1 transcript that produces an Ank1 isoform that lacks most of the regulatory domain of canonical erythrocyte Ank1 (23). A muscle-specific Ank1 isoform (sAnk1) with multiple transcripts (3.5-, 2.0-, and 1.6-kb) generated by the use of a muscle-specific promoter and alternative splicing has been identified in skeletal and cardiac muscle (4;23). Analysis of the sAnk1 cDNA sequence determined that the cDNA has four exons: a novel exon 1 (located in intron 39 of the erythroid Ank1 gene) followed by the erythroid exons 40, 41, and 42; the alternative sAnk1 transcripts differ in the use of exon 41 (4). The major sAnk1 isoform of the muscle is a 155-amino acid protein that lacks both the membrane- and spectrin-binding domains (4;23;37;38). The sAnk1 isoform has a novel 72-amino acid segment at the N-terminus that is predicted to contain a single membrane-spanning helix, but it shares the C-terminal sequence of canonical Ank1 (4;23;37;38).

In erythrocytes, Ank1 is bound to the cytoplasmic surface of the membrane (39). In the cerebellum, Ank1 localizes to Purkinje and granule cells (36). Immunoblot analysis detected predominant expression of 28- and 30-kDa proteins in skeletal muscles (4). In skeletal muscle, sAnk1 is localized to the neuromuscular junction (40), triads (41), and the sarcolemma (38;42). In the sarcolemma, sAnk1 isoforms interact with the membrane of the sarcoplasmic reticulum (4;37;38). The protein encoded by the 1.6-kb sAnk1 transcript is localized near or at the M line, where it colocalizes with obscurin (43). Other studies observed that sAnk1 was localized at the Z line and M line in skeletal muscles (38). The differences in the documented localizations are proposed to be due to experimental differences (detection of tagged sAnk1 expressed from transfected cDNA in primary cell cultures (43) versus detection of endogenous sAnk1 in muscle tissues (38)). In addition, the polyclonal antibody used in (38) was not specific for a particular sAnk1 isoform.

Background

The ankyrin proteins function as linker/adaptor molecules that attach a membrane skeleton to the plasma membrane lipid bilayer (44;45). Ank1, Ank2, and Ank3 are characterized by their primary sites of localization: Ank1, erythroid; Ank2, brain; and Ank3, kidney [reviewed in (46)]. The ankyrin proteins are involved in regulating several cellular activities including cell adhesion, signal transduction, organelle movement, cell motility, receptor batching and capping, membrane transport, protein secretion, tumor metastasis, and cell division through interactions with plasma membrane-associated proteins (e.g., band 3, α₁-Na⁺, K⁺-ATPase, the amiloride-sensitive Na⁺ channel (ASSC), Ca²⁺ channels, and CD44) (10;12-14;47;48).

Figure 9. Ankyrin-1 maintains the structural integrity of red blood cells.

Ank1 has several documented functions:

Ank1 maintains the structural integrity of red blood cells (Figure 9). In RBCs, the spectrin-based membrane cytoskeleton is attached to band 3 and protein 4.2 (a peripheral RBC membrane protein) via associations with Ank1 at the plasma membrane to maintain membrane surface area (5;10;46;49;50). Furthermore, the association of Ank1 with band 3 facilitates the vertical stability and reversible deformability of the red cell membrane (29). Disruption in the association of ankyrin with spectrin, band 3, or protein 4.2 leads to accumulation of dysmorphic RBCs in the spleen, RBC fragmentation, and hemolytic anemia (30).
Ank1 provides structural support in muscle. In skeletal muscle, the sAnk1 isoform interacts with the C-terminus of obscurin, a component of myofibrils (43). This interaction connects the sarcoplasmic reticulum, with which sAnk1 is associated, and the myofibrils. The sAnk1-obscurin complex thus directs the structural organization of muscle cells and possibly the distribution of proteins at the sarcoplasmic reticulum (43).
Ank1 regulates T cell activation. In addition to its known functions in erythroid cells and muscle, Ank1 is also involved in an association with the inositol 1,4,5-trisphosphate (IP₃) receptor in mouse T-lymphoma cells (48). The association of Ank1 with the IP₃ receptor inhibited IP₃-induced internal calcium release from isolated light density vesicles of T lymphoma cells. Bourguignon et al. proposed that the linkage between cell membrane proteins such as CD44 and organelle calcium channels such as the IP₃ receptor may be important for lymphocyte activation (48). Ank1 and βI spectrin associate with CD45 in peripheral lymphocytes and Jurkat T cells to mediate the movement of CD45 and CD3 to the lymphocyte surface, and then to laterally immobilize CD45 in the membrane, processes essential for T cell activation (51;52).
Ank1 facilitates protein transport in the secretory pathway. Ank1 is proposed to function, along with spectrin, as an organelle stabilizer and/or as a tether to link transport intermediates to motors (19;53;54). Studies have identified ankyrin as a facilitator of α1-Na⁺-K⁺-ATPase transport through the secretory pathway (19). The association of Ank1 with α1-Na⁺-K⁺-ATPase is proposed to function in the protection of α1-Na⁺-K⁺-ATPase from capture by ADP-ribosylation factor 1 (ARF1)-activated COPI-mediated retrograde pathways returning to the ER, however, this has not been experimentally verified (19).
Ank1 may influence cancer cell metastasis through regulation of Rho GTPases. Ankyrin association with the guanine nucleotide exchange factor Tiam1 (T cell lymphoma invasion and metastasis 1) in membrane projections of SP-1 breast tumor cells leads to the activation of the Rho-like GTPase Rac1, cytoskeletal changes, and tumor cell invasion and migration (14).

Ankyrin 1 deficiency causes anemia

Mutations in ANK1 are linked to spherocytosis type 1 [OMIM: #182900; (55)], a hemolytic anemia characterized by spherical red cells and increased RBC osmotic fragility [reviewed in (56)]. In addition to anemia and spherocytic erythrocytes, patients with spherocytosis can also exhibit jaundice (55). Mutations in band 3, α- and β-spectrin, and protein 4.2 can also cause spherocytosis, but over 50% of the documented cases are caused by ANK1 mutations [reviewed in (50;56)]. Missense mutations as well as mutations within the ANK1 promoter are common in recessive spherocytosis, while frameshift and nonsense mutations are common in dominant spherocytosis (57).

Ank1 mouse models

Mouse models have been characterized that have both spontaneous (i.e., the normoblastosis and pale mutants) and ENU-induced mutations in Ank1. These mouse models have several phenotypes in common, including the pathological features of hereditary spherocytosis: severe anemia, reticulocytosis, splenomegaly with disturbances in splenic architecture, multiorgan iron overload, low body weight, and most also display embryonic or early postnatal lethality (29;30;44;58-60). Several of these mutants are described in more detail, below.

The normoblastosis mutant

The normoblastosis mutation (Ank1^nb/nb; alternatively, nb; MGI:1856298) is a spontaneous deletion of guanosine 4367 (exon 36) that results in a frame shift and the introduction of a premature stop codon 13 codons downstream of the deletion (61). The nb mutation results in a reduction in the amount of the 7.5- and 9.0-kb transcripts in both erythroid tissues and the cerebellum (36;62). Mutant mice produce a hypomorphic 157 kDa Ank1 protein that has normal membrane and spectrin-binding domains, but does not have the regulatory domain (61;63).

The nb mice are phenotypically normal (i.e., blood cell counts, reticulocyte counts, tissue iron deposition, and RBC morphology) by as late as embryonic day (E) 16-E18 (62). However, within the first 24 hours after birth, the nb mutants exhibit lower RBC numbers (and variations in size and density), reticulocytosis, abnormal iron homeostasis, increased erythrocyte protoporphyrin levels, and the appearance of microspherocytes (62;64;65). The nb mutants develop hemolytic anemia (62;66;67) as well as age-related neurological issues characterized by a persistent tremor and awkward gait due to an extensive loss of Purkinje cells with time (36;61). Furthermore, these mice exhibit partial preweaning lethality, infertility, cardiac hypertrophy, and reduced body size (66;67). Other studies have described the nb mutants has having an abnormal skin pigmentation at birth that fades with age (67). The levels of several Ank1-associated proteins are reduced in the nb mice: spectrin is reduced to 50% of wild-type levels, protein 4.2 is also reduced, and band 3 is reduced to ~50% wild-type levels (44;60;68). The morphological changes observed in the nb RBCs are proposed to be a result of the combined spectrin and Ank1 deficiencies (60), although other studies have determined that Ank1 deficiency does not abrogate the assembly of a two-dimensional spectrin-based membrane skeleton (44).

The pale mutant

Another spontaneous mutation has been identified in Ank1 (Ank1^pale/pale; alternatively, pale; MGI:4367449). The pale mutation is a G to A transition that disrupts the AG dinucleotide of the splice acceptor of intron 26. Alterations in the mRNA and/or protein levels have not been described. This mutation results in complete postnatal lethality by one month, decreased body size, and abnormal skin pigmentation at birth.

ENU-induced Ank1 mutations

Studies have also described ENU-induced Ank1 mutations (29;30;58;59). One mutant (Ank1^E924X; MGI:4947988) is a G to T transition in exon 27 that results in substitution of a stop codon for glutamic acid at position 924 [E924*; (29)]. The predicted protein product is truncated 38 residues N-terminal to the ZU5 subdomain, eliminating the C-terminal regulatory domain and most of the spectrin-binding domain (29). Mice homozygous for the Ank1^E924X mutation do not express detectable full-length canonical isoforms of Ank1, but do express several unique isoforms or degraded ankyrin protein products (29). Heterozygotes exhibit low RBC mean corpuscular volume, elevated RBC counts, slight reticulocytosis, and mildly increased osmotic fragility (29). Hughes et al. characterized this mutation on two genetic backgrounds (C3H/HeJ or SvImJ/129) and found that homozygotes are not viable on either one. However, on a mixed background (C3H/HeJ x SvImJ/129) some homozygous mice are born and survive. They display classical severe hemolytic spherocytosis resulting from RBC membrane destabilization, as well as anemia, chronic compensatory extramedullary hematopoiesis, stress erythropoiesis, and chronic hemolysis (29).

Rank et al. described another ENU-induced null mutation that results in the loss of Ank1 protein expression due to a G to C transversion at the splice acceptor site of intron 40 [RBC2; MGI:3844284; (30)]. Sequence analysis determined the presence of an alternative splice acceptor site 22 nucleotides 3’ that induced a frame shift after amino acid 1674 (30). Following the frameshift are 96 amino acid residues and a premature stop codon; Western blot analysis did not detect Ank1 protein in the homozygous mutants (30). This mutation, designated RBC2, also results in a reduction in spectrin, protein 4.2, Rh, and GPA levels (30). These mice exhibit severe hemolysis, anemia, increased spleen size, and partial embryonic or neonatal lethality (30). All homozygous animals succumbed by two months (30). This mutation resulted in structural loss of the 2-dimensional array of junctional complexes cross-linked by spectrin tetramers in the red cell cytoskeleton (30). These mice also exhibit increased resistance to malaria (P. chabaudi) (30).

Another study further examined Ank1-mediated malaria resistance using an ENU-induced Ank1 mutant. Greth et al. described a T to A transversion in exon 11 of Ank1 that results in substitution of a stop codon for leucine at position 422 [Ank1^MRI23420; MGI:5438699; (59)]. Full-length Ank1 was not detected in homozygous mutant samples by Western blot analysis, however, a ~50 kDa band was present that matched the theoretical size of the truncated form of the mutant protein (59). Homozygous animals exhibit postnatal death by 48 hours after birth accompanied by jaundice due to massive hemolysis (59). Heterozygous animals have regenerative anemia, splenomegaly with iron overload, and an increase in malaria resistance (59). Heterozygous Ank1^MRI23420 mice display greater resistance to malaria than heterozygous nb mice; the underlying cause for the disparity is unknown (65). Greth et al. have shown that fewer RBCs are infected by P. chabaudi in heterozygous Ank1^MRI23420 mice compared to wild type mice, and those P. chabaudi that have infected mutant RBCs exhibit a reduced survival rate compared to those infecting wild type RBCs (59).

A recent study described an ENU-induced nonsense mutant with increased susceptibility to Salmonella Typhimurium infection [Ank1^Ity16; (58)]. The Ity16 mutation is a C to T transition at position 4069 in the Ank1 transcript that results in a glutamine to premature stop codon substitution within exon 33 at amino acid position 1357 (58). The mutation results in truncation of the Ank1 protein by 550 amino acids and the subsequent loss of both the C-terminal regulatory and death domains; the membrane-binding domain and most of the spectrin-binding domain are intact; no protein product is detected in homozygous mutants (58). Both heterozygous and homozygous Ity16 animals exhibit increased susceptibility to Salmonella, but the heterozygotes have a delayed and milder phenotype relative to homozygotes (58). Furthermore, the Ity16 homozygous animals have severe anemia, an increased number of circulating reticulocytes, changes to RBC morphology, reticulocytosis, extramedullary erythropoiesis, lower body weight, pallor of mucosal linings, yellow discoloration of subcutaneous tissues, an increase in white blood cells, neutrophils, and lymphocytes, and enlargement of the spleen, kidney, and heart (58). Yuki et al. determined that it was by a suppression of hepcidin (Hamp) expression and iron overload that this model had increased susceptibility to Salmonella (58). Iron overload causes decreased macrophage-mediated phagocytosis, reduced neutrophil migration, suppression of the complement system, increased oxidative stress, and modification of T-cell subsets (69).

Putative Mechanism

Figure 10. Band 3 extractability from the RBC membrane skeleton in wild-type and Hema6 mice. Ghost membrane proteins were extracted with Triton X-100 at indicated concentration, and proteins released into the supernatant were analyzed by SDS-PAGE and probed with antibody against band 3. Result shown here is representative of three independent experiments. Figure obtained from (2).

The Hema6 mutation results in modestly decreased expression of the Ank1 protein leading to mild hereditary spherocytosis in heterozygous and homozygous mice. The Hema6 mutation results in a weakened linkage between the RBC membrane and the cytoskeleton, as shown by the increased detergent extractability of band 3 from homozygous RBC ghost membranes [Figure 10; (2)]. This finding is consistent with previous reports that reductions in expression of Ank1, spectrin, band 3, and/or protein 4.2 in Ank1 mutants impair the interaction between the membrane and cytoskeleton and lead to membrane deformation and reductions in membrane surface area (30;44;60;68).

Primers

Primers cannot be located by automatic search.

Genotyping

Hema6 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

PCR Primers

Hema6(F): 5’- CGAGACAGGGCTTGCTTGTCGATAG-3’

Hema6(R): 5’- GTGAAGCGGTGTCTGGTCATCCTG-3’

Sequencing Primer

Hema6_seq(F): 5’- AACCAACAGGAACGCCTTGTG-3’ 

Hema6_seq(R): 5’- CGTTAACCTTCCCAAGTCCAACTC -3’

Master Mix

Using Jumpstart Premix (Sigma):

PCR premix (2x) 25 ul

Forward primer(10uM) 2ul

Reverse primer(10uM) 2ul

gDNA template ~100ng

dH₂O appropriate

50ul

PCR program

1) 94°C 2:00

2) 94°C 0:30

3) 55°C 0:30

4) 72°C 1:00

5) repeat steps (2-4) 40X

6) 72°C 10:00

7) 4°C ∞

The following sequence of 400 nucleotides (from Genbank genomic region NC_000074 for linear DNA sequence of Ank1) is amplified:

122632 cgagacagg

122641 gcttgcttgt cgatagcaaa cggtttgctg agtatcttct ctgaaaccaa caggaacgcc

122701 ttgtgtccat tagctgttga tctgaaccct aaccctatga aataatgtta caattcgcac

122761 ttaaactgag gaagctgaac ctttgggcaa ttaagtagca ataaccgtga agctggtgag

122821 ttgtaaggac tgaactaagt agagcatgta gtttctgtta agtcagagac tggaagaaag

122881 tccagatctt ttgattcatt gtgagtcact tgcagggtct ggtcctcacc tccttgccct

122941 atgaaataat acagagttgg acttgggaag gttaacgtgt ccagttttct actttcaccc

123001 cgtggcccag gatgaccaga caccgcttca c

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References

1. Krieg, L., Milstein, O., Krebs, P., Xia, Y., Beutler, B., and Du, X. (2011) Mutation of the Gastric Hydrogen-Potassium ATPase Alpha Subunit Causes Iron-Deficiency Anemia in Mice. Blood. 118, 6418-6425.

2. Huang, H., Zhao, P., Arimatsu, K., Tabeta, K., Yamazaki, K., Krieg, L., Fu, E., Zhang, T., and Du, X. (2013) A Deep Intronic Mutation in the Ankyrin-1 Gene Causes Diminished Protein Expression Resulting in Hemolytic Anemia in Mice. G3 (Bethesda). 3, 1687-1695.

3. Bennett, V. (1979) Immunoreactive Forms of Human Erythrocyte Ankyrin are Present in Diverse Cells and Tissues. Nature. 281, 597-599.

4. Gallagher, P. G., and Forget, B. G. (1998) An Alternate Promoter Directs Expression of a Truncated, Muscle-Specific Isoform of the Human Ankyrin 1 Gene. J Biol Chem. 273, 1339-1348.

5. Bennett, V. (1992) Ankyrins. Adaptors between Diverse Plasma Membrane Proteins and the Cytoplasm. J Biol Chem. 267, 8703-8706.

6. Lambert, S., and Bennett, V. (1993) From Anemia to Cerebellar Dysfunction. A Review of the Ankyrin Gene Family. Eur J Biochem. 211, 1-6.

7. White, R. A., Birkenmeier, C. S., Peters, L. L., Barker, J. E., and Lux, S. E. (1992) Murine Erythrocyte Ankyrin cDNA: Highly Conserved Regions of the Regulatory Domain. Mamm Genome. 3, 281-285.

8. Lux, S. E., John, K. M., and Bennett, V. (1990) Analysis of cDNA for Human Erythrocyte Ankyrin Indicates a Repeated Structure with Homology to Tissue-Differentiation and Cell-Cycle Control Proteins. Nature. 344, 36-42.

9. Platt, O. S., Lux, S. E., and Falcone, J. F. (1993) A Highly Conserved Region of Human Erythrocyte Ankyrin Contains the Capacity to Bind Spectrin. J Biol Chem. 268, 24421-24426.

10. Davis, L. H., and Bennett, V. (1990) Mapping the Binding Sites of Human Erythrocyte Ankyrin for the Anion Exchanger and Spectrin. J Biol Chem. 265, 10589-10596.

11. Davis, L. H., Otto, E., and Bennett, V. (1991) Specific 33-Residue Repeat(s) of Erythrocyte Ankyrin Associate with the Anion Exchanger. J Biol Chem. 266, 11163-11169.

12. Zhu, D., and Bourguignon, L. Y. (2000) Interaction between CD44 and the Repeat Domain of Ankyrin Promotes Hyaluronic Acid-Mediated Ovarian Tumor Cell Migration. J Cell Physiol. 183, 182-195.

13. Bourguignon, L. Y., Lokeshwar, V. B., He, J., Chen, X., and Bourguignon, G. J. (1992) A CD44-Like Endothelial Cell Transmembrane Glycoprotein (GP116) Interacts with Extracellular Matrix and Ankyrin. Mol Cell Biol. 12, 4464-4471.

14. Bourguignon, L. Y., Zhu, H., Shao, L., and Chen, Y. W. (2000) Ankyrin-Tiam1 Interaction Promotes Rac1 Signaling and Metastatic Breast Tumor Cell Invasion and Migration. J Cell Biol. 150, 177-191.

15. Michaely, P., Tomchick, D. R., Machius, M., and Anderson, R. G. (2002) Crystal Structure of a 12 ANK Repeat Stack from Human ankyrinR. EMBO J. 21, 6387-6396.

16. Browne, G. J., Fardilha, M., Oxenham, S. K., Wu, W., Helps, N. R., da Cruz E Silva, O. A., Cohen, P. T., and da Cruz E Silva, E. F. (2007) SARP, a New Alternatively Spliced Protein Phosphatase 1 and DNA Interacting Protein. Biochem J. 402, 187-196.

17. Gupta, S., and Sen, S. (2002) Myotrophin-kappaB DNA Interaction in the Initiation Process of Cardiac Hypertrophy. Biochim Biophys Acta. 1589, 247-260.

18. Davis, J. Q., and Bennett, V. (1990) The Anion Exchanger and Na+K(+)-ATPase Interact with Distinct Sites on Ankyrin in in Vitro Assays. J Biol Chem. 265, 17252-17256.

19. Stabach, P. R., Devarajan, P., Stankewich, M. C., Bannykh, S., and Morrow, J. S. (2008) Ankyrin Facilitates Intracellular Trafficking of alpha1-Na+-K+-ATPase in Polarized Cells. Am J Physiol Cell Physiol. 295, C1202-14.

20. Devarajan, P., Scaramuzzino, D. A., and Morrow, J. S. (1994) Ankyrin Binds to Two Distinct Cytoplasmic Domains of Na,K-ATPase Alpha Subunit. Proc Natl Acad Sci U S A. 91, 2965-2969.

21. Jordan, C., Puschel, B., Koob, R., and Drenckhahn, D. (1995) Identification of a Binding Motif for Ankyrin on the Alpha-Subunit of Na+,K(+)-ATPase. J Biol Chem. 270, 29971-29975.

22. Zhang, Z., Devarajan, P., Dorfman, A. L., and Morrow, J. S. (1998) Structure of the Ankyrin-Binding Domain of Alpha-Na,K-ATPase. J Biol Chem. 273, 18681-18684.

23. Birkenmeier, C. S., White, R. A., Peters, L. L., Hall, E. J., Lux, S. E., and Barker, J. E. (1993) Complex Patterns of Sequence Variation and Multiple 5' and 3' Ends are found among Transcripts of the Erythroid Ankyrin Gene. J Biol Chem. 268, 9533-9540.

24. Lambert, S., Yu, H., Prchal, J. T., Lawler, J., Ruff, P., Speicher, D., Cheung, M. C., Kan, Y. W., and Palek, J. (1990) CDNA Sequence for Human Erythrocyte Ankyrin. Proc Natl Acad Sci U S A. 87, 1730-1734.

25. Hall, T. G., and Bennett, V. (1987) Regulatory Domains of Erythrocyte Ankyrin. J Biol Chem. 262, 10537-10545.

26. Davis, L. H., Davis, J. Q., and Bennett, V. (1992) Ankyrin Regulation: An Alternatively Spliced Segment of the Regulatory Domain Functions as an Intramolecular Modulator. J Biol Chem. 267, 18966-18972.

27. Gallagher, P. G., Tse, W. T., Scarpa, A. L., Lux, S. E., and Forget, B. G. (1997) Structure and Organization of the Human Ankyrin-1 Gene. Basis for Complexity of Pre-mRNA Processing. J Biol Chem. 272, 19220-19228.

28. Gallagher, P. G., Tse, W. T., Scarpa, A. L., Lux, S. E., and Forget, B. G. (1992) Large Numbers of Alternatively Spliced Isoforms of the Regulatory Region of Human Erythrocyte Ankyrin. Trans Assoc Am Physicians. 105, 268-277.

29. Hughes, M. R., Anderson, N., Maltby, S., Wong, J., Berberovic, Z., Birkenmeier, C. S., Haddon, D. J., Garcha, K., Flenniken, A., Osborne, L. R., Adamson, S. L., Rossant, J., Peters, L. L., Minden, M. D., Paulson, R. F., Wang, C., Barber, D. L., McNagny, K. M., and Stanford, W. L. (2011) A Novel ENU-Generated Truncation Mutation Lacking the Spectrin-Binding and C-Terminal Regulatory Domains of Ank1 Models Severe Hemolytic Hereditary Spherocytosis. Exp Hematol. 39, 305-20, 320.e1-2.

30. Rank, G., Sutton, R., Marshall, V., Lundie, R. J., Caddy, J., Romeo, T., Fernandez, K., McCormack, M. P., Cooke, B. M., Foote, S. J., Crabb, B. S., Curtis, D. J., Hilton, D. J., Kile, B. T., and Jane, S. M. (2009) Novel Roles for Erythroid Ankyrin-1 Revealed through an ENU-Induced Null Mouse Mutant. Blood. 113, 3352-3362.

31. Morgans, C. W., and Kopito, R. R. (1993) Association of the Brain Anion Exchanger, AE3, with the Repeat Domain of Ankyrin. J Cell Sci. 105 ( Pt 4), 1137-1142.

32. Kordeli, E., Ludosky, M. A., Deprette, C., Frappier, T., and Cartaud, J. (1998) AnkyrinG is Associated with the Postsynaptic Membrane and the Sarcoplasmic Reticulum in the Skeletal Muscle Fiber. J Cell Sci. 111 ( Pt 15), 2197-2207.

33. Gallagher, P. G., Romana, M., Tse, W. T., Lux, S. E., and Forget, B. G. (2000) The Human Ankyrin-1 Gene is Selectively Transcribed in Erythroid Cell Lines Despite the Presence of a Housekeeping-Like Promoter. Blood. 96, 1136-1143.

34. Kordeli, E., and Bennett, V. (1991) Distinct Ankyrin Isoforms at Neuron Cell Bodies and Nodes of Ranvier Resolved using Erythrocyte Ankyrin-Deficient Mice. J Cell Biol. 114, 1243-1259.

35. Peters, L. L., White, R. A., Birkenmeier, C. S., Bloom, M. L., Lux, S. E., and Barker, J. E. (1992) Changing Patterns in Cytoskeletal mRNA Expression and Protein Synthesis during Murine Erythropoiesis in Vivo. Proc Natl Acad Sci U S A. 89, 5749-5753.

36. Peters, L. L., Birkenmeier, C. S., Bronson, R. T., White, R. A., Lux, S. E., Otto, E., Bennett, V., Higgins, A., and Barker, J. E. (1991) Purkinje Cell Degeneration Associated with Erythroid Ankyrin Deficiency in nb/nb Mice. J Cell Biol. 114, 1233-1241.

37. Birkenmeier, C. S., Sharp, J. J., Gifford, E. J., Deveau, S. A., and Barker, J. E. (1998) An Alternative First Exon in the Distal End of the Erythroid Ankyrin Gene Leads to Production of a Small Isoform Containing an NH2-Terminal Membrane Anchor. Genomics. 50, 79-88.

38. Zhou, D., Birkenmeier, C. S., Williams, M. W., Sharp, J. J., Barker, J. E., and Bloch, R. J. (1997) Small, Membrane-Bound, Alternatively Spliced Forms of Ankyrin 1 Associated with the Sarcoplasmic Reticulum of Mammalian Skeletal Muscle. J Cell Biol. 136, 621-631.

39. Bennett, V., and Stenbuck, P. J. (1979) Identification and Partial Purification of Ankyrin, the High Affinity Membrane Attachment Site for Human Erythrocyte Spectrin. J Biol Chem. 254, 2533-2541.

40. Flucher, B. E., and Daniels, M. P. (1989) Distribution of Na+ Channels and Ankyrin in Neuromuscular Junctions is Complementary to that of Acetylcholine Receptors and the 43 Kd Protein. Neuron. 3, 163-175.

41. Flucher, B. E., Morton, M. E., Froehner, S. C., and Daniels, M. P. (1990) Localization of the Alpha 1 and Alpha 2 Subunits of the Dihydropyridine Receptor and Ankyrin in Skeletal Muscle Triads. Neuron. 5, 339-351.

42. Nelson, W. J., and Lazarides, E. (1984) Goblin (Ankyrin) in Striated Muscle: Identification of the Potential Membrane Receptor for Erythroid Spectrin in Muscle Cells. Proc Natl Acad Sci U S A. 81, 3292-3296.

43. Bagnato, P., Barone, V., Giacomello, E., Rossi, D., and Sorrentino, V. (2003) Binding of an Ankyrin-1 Isoform to Obscurin Suggests a Molecular Link between the Sarcoplasmic Reticulum and Myofibrils in Striated Muscles. J Cell Biol. 160, 245-253.

44. Yi, S. J., Liu, S. C., Derick, L. H., Murray, J., Barker, J. E., Cho, M. R., Palek, J., and Golan, D. E. (1997) Red Cell Membranes of Ankyrin-Deficient nb/nb Mice Lack Band 3 Tetramers but Contain Normal Membrane Skeletons. Biochemistry. 36, 9596-9604.

45. Bennett, V., and Baines, A. J. (2001) Spectrin and Ankyrin-Based Pathways: Metazoan Inventions for Integrating Cells into Tissues. Physiol Rev. 81, 1353-1392.

46. Peters, L. L., and Lux, S. E. (1993) Ankyrins: Structure and Function in Normal Cells and Hereditary Spherocytes. Semin Hematol. 30, 85-118.

47. Bourguignon, L. Y., and Bourguignon, G. J. (1984) Capping and the Cytoskeleton. Int Rev Cytol. 87, 195-224.

48. Bourguignon, L. Y., Jin, H., Iida, N., Brandt, N. R., and Zhang, S. H. (1993) The Involvement of Ankyrin in the Regulation of Inositol 1,4,5-Trisphosphate Receptor-Mediated Internal Ca2+ Release from Ca2+ Storage Vesicles in Mouse T-Lymphoma Cells. J Biol Chem. 268, 7290-7297.

49. Bennett, V., and Stenbuck, P. J. (1980) Association between Ankyrin and the Cytoplasmic Domain of Band 3 Isolated from the Human Erythrocyte Membrane. J Biol Chem. 255, 6424-6432.

50. Mohandas, N., and Gallagher, P. G. (2008) Red Cell Membrane: Past, Present, and Future. Blood. 112, 3939-3948.

51. Pradhan, D., and Morrow, J. (2002) The Spectrin-Ankyrin Skeleton Controls CD45 Surface Display and Interleukin-2 Production. Immunity. 17, 303-315.

52. Cairo, C. W., Das, R., Albohy, A., Baca, Q. J., Pradhan, D., Morrow, J. S., Coombs, D., and Golan, D. E. (2010) Dynamic Regulation of CD45 Lateral Mobility by the Spectrin-Ankyrin Cytoskeleton of T Cells. J Biol Chem. 285, 11392-11401.

53. Lorra, C., and Huttner, W. B. (1999) The Mesh Hypothesis of Golgi Dynamics. Nat Cell Biol. 1, E113-5.

54. De Matteis, M. A., and Morrow, J. S. (2000) Spectrin Tethers and Mesh in the Biosynthetic Pathway. J Cell Sci. 113 ( Pt 13), 2331-2343.

55. Gallagher, P. G., Steiner, L. A., Liem, R. I., Owen, A. N., Cline, A. P., Seidel, N. E., Garrett, L. J., and Bodine, D. M. (2010) Mutation of a Barrier Insulator in the Human Ankyrin-1 Gene is Associated with Hereditary Spherocytosis. J Clin Invest. 120, 4453-4465.

56. Perrotta, S., Gallagher, P. G., and Mohandas, N. (2008) Hereditary Spherocytosis. Lancet. 372, 1411-1426.

57. Eber, S. W., Gonzalez, J. M., Lux, M. L., Scarpa, A. L., Tse, W. T., Dornwell, M., Herbers, J., Kugler, W., Ozcan, R., Pekrun, A., Gallagher, P. G., Schroter, W., Forget, B. G., and Lux, S. E. (1996) Ankyrin-1 Mutations are a Major Cause of Dominant and Recessive Hereditary Spherocytosis. Nat Genet. 13, 214-218.

58. Yuki, K. E., Eva, M. M., Richer, E., Chung, D., Paquet, M., Cellier, M., Canonne-Hergaux, F., Vaulont, S., Vidal, S. M., and Malo, D. (2013) Suppression of Hepcidin Expression and Iron Overload Mediate Salmonella Susceptibility in Ankyrin 1 ENU-Induced Mutant. PLoS One. 8, e55331.

59. Greth, A., Lampkin, S., Mayura-Guru, P., Rodda, F., Drysdale, K., Roberts-Thomson, M., McMorran, B. J., Foote, S. J., and Burgio, G. (2012) A Novel ENU-Mutation in Ankyrin-1 Disrupts Malaria Parasite Maturation in Red Blood Cells of Mice. PLoS One. 7, e38999.

60. Rybicki, A. C., Musto, S., and Schwartz, R. S. (1995) Decreased Content of Protein 4.2 in Ankyrin-Deficient Normoblastosis (nb/nb) Mouse Red Blood Cells: Evidence for Ankyrin Enhancement of Protein 4.2 Membrane Binding. Blood. 86, 3583-3589.

61. Birkenmeier, C. S., Gifford, E. J., and Barker, J. E. (2003) Normoblastosis, a Murine Model for Ankyrin-Deficient Hemolytic Anemia, is Caused by a Hypomorphic Mutation in the Erythroid Ankyrin Gene Ank1. Hematol J. 4, 445-449.

62. Peters, L. L., Birkenmeier, C. S., and Barker, J. E. (1992) Fetal Compensation of the Hemolytic Anemia in Mice Homozygous for the Normoblastosis (Nb) Mutation. Blood. 80, 2122-2127.

63. White, R. A., Birkenmeier, C. S., Lux, S. E., and Barker, J. E. (1990) Ankyrin and the Hemolytic Anemia Mutation, Nb, Map to Mouse Chromosome 8: Presence of the Nb Allele is Associated with a Truncated Erythrocyte Ankyrin. Proc Natl Acad Sci U S A. 87, 3117-3121.

64. Sassa, S., and Bernstein, S. E. (1978) Studies of Erythrocyte Protoporphyrin in Anemic Mutant Mice: Use of a Modified Hematofluorometer for the Detection of Heterozygotes for Hemolytic Disease. Exp Hematol. 6, 479-487.

65. Shear, H. L., Roth, E. F.,Jr, Ng, C., and Nagel, R. L. (1991) Resistance to Malaria in Ankyrin and Spectrin Deficient Mice. Br J Haematol. 78, 555-560.

66. Bernstein, S. E. (1980) Inherited Hemolytic Disease in Mice: A Review and Update. Lab Anim Sci. 30, 197-205.

67. Bernstein, S. E. (1969) Hereditary Disorders of the Rodent Erythron, in Genetics in Laboratory Animal Medicine (J. R. Lindsay, Ed.) pp 9-33, Natl Acad Sci Publ, Washington, DC.

68. Bodine, D. M.,4th, Birkenmeier, C. S., and Barker, J. E. (1984) Spectrin Deficient Inherited Hemolytic Anemias in the Mouse: Characterization by Spectrin Synthesis and mRNA Activity in Reticulocytes. Cell. 37, 721-729.

69. Walker, E. M.,Jr, and Walker, S. M. (2000) Effects of Iron Overload on the Immune System. Ann Clin Lab Sci. 30, 354-365.

Science Writers

Anne Murray

Illustrators

Peter Jurek

Authors

Xin Du, Lara Krieg