Phenotypic Mutation 'potbelly'

• Allele: potbelly
• Mutation Type: nonsense
• Chromosome: 6
• Coordinate: 29,068,971 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Lep
• Gene Name: leptin
• Chromosomal Location: 29,060,220-29,073,875 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes are obese, hyperphagic, have low activity, high metabolic efficiency, impaired thermogenesis, infertility and short lifespan in addition to varying other abnormalities. Strain background affects severity and course of diabetes. Heterozygotes survive fasting longer than control mice. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000067046] [ENSMUSP00000130087]
• AlphaFold: P41160
• SMART Domains: Protein: ENSMUSP00000067046; Gene: ENSMUSG00000059201; AA Change: C7*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Leptin	23	167	5.8e-71	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000130087; Gene: ENSMUSG00000059201; AA Change: C7*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Leptin	22	98	5.9e-50	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 036787-MU
• Last Updated: 2016-12-08 11:53 AM by Anne Murray
• Record Created: 2012-11-01 2:14 PM by Hexin Shi
• Record Posted: 2013-01-03
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Hexin Shi, Ying Wang, Bruce Beutler

Accession Number

Ncbi Refseq: NM_008493.3; MGI:104663

Alleles Listed at MGI

All alleles(6) : Targeted(3) Spontaneous(2) Chemically induced(1)

Phenotypic Description

Figure 1. Ventral (left) and dorsal (right) views of potbelly mice. In each picture, potbelly mice (right mouse) is shown next to a wild-type animal (left mouse).

Figure 2. Fat ratio (as determined from MRI) of potbelly and wild-type littermates.

The potbelly phenotype was identified among ENU-induced G3 mutant mice (Figure 1).  Preliminary data indicate potbelly mice develop severe obesity (Figure 1 & 2), but not diabetes.

Nature of Mutation

The potbelly mutation corresponds to a T to A transversion at position 21 of the Lep transcript (ENSMUST00000069789; version NCBIM37) in exon 2 of 3 total exons.

1 ATGTGCTGGAGACCCCTGTGTCGGTTCCTGTGGCTTTGGTCC

1 -M--C--W--R--P--L--C--R--F--L--W--L--W--S-

The mutated nucleotide is indicated in red lettering and results in a conversion of cysteine 7 to a stop codon.

Protein Prediction

Figure 3. Mouse leptin domains. Mouse leptin contains a signal peptide (SP) at aa 1-21 that is cleaved during protein maturation.  The residues that consitute the four-helix bundle (helices A-D) are labeled.  The cysteines at aa 117 and 167 form a intramolecular disulfide bond between the C-terminus and the beginning of the CD loop. The residues at 140-142 (i.e., Tyr (Y)-140, Ser (S)-141, and Thr (T)-142) are required for leptin-mediated activation of the LepR. The potbelly mutation results in coding of a premature stop codon at amino acid 7 within the N-terminal signal peptide region.

The Lep (alternatively, ob) gene encodes leptin, a highly conserved [e.g., mouse and human leptin share 84% sequence identity (1-3)] adipocyte-secreted hormone and member of the class I helical cytokine family [Figure 3; (4-9)]. Leptin regulates several physiological processes including appetite, energy homeostasis, body weight, neuroendocrine systems [i.e., the growth hormone axis, thyroid axis, hypothalamic-pituitary-gonadal axis, and adrenal axis (10-13)], immune functions (i.e., thymic homeostasis, secretion of IL-1 and TNF-α, and promotion of Th1-cell differentiation [reviewed in (14)]), and glycaemia [reviewed in (15;16)].

Figure 4. The crystal structure of human leptin. The model is based on PDB: 1AX8. Leptin has a four-helix bundle (helices A-D) with an up-up-down-down topology. Parallel to the helical bundle is a hydrophobic cylindrical core formed from conserved residues of the four alpha helices. Leptin has a small helical segment (i.e., helix E) within the loop between helices C and D.

The crystal structure of human leptin has been solved [PDB: 1AX8; (17); Figure 4].  In order to prevent leptin aggregation and to generate a biologically active and soluble leptin, amino acid Trp (W) 100 was mutated to a Glu (E100) (17). The leptin (E100) tertiary structure resembles that of other class I cytokines [e.g., granulocyte colony-stimulating factor (G-CSF), IL-6, gp130 family members, leukemia inhibitory factor (LIF), ciliary neurotrophic factor (CNTF), and human growth hormone (hGH)] in that it has a four-helix bundle (helices A-D) with an up-up-down-down topology (17-19). A nuclear magnetic resonance (NMR) study determined that in mouse leptin, Helix A is amino acids 3-24, Helix B is aa 51-67, Helix C is aa 72-94, and Helix D is aa 122-141 (18). Parallel to the helical bundle is a hydrophobic cylindrical core formed from conserved residues of the four alpha helices (17). Leptin differs structurally from other class I cytokines in that it has a small helical segment (i.e., helix E) within the loop between helices C and D [aa 95-121 (17)]; the other cytokines have kinks in the middle of helix A, D, or B (4;17).  The length and position of the helices in leptin are most similar to cytokines of the short-helix family (20) such as interleukin-2 (21), interleukin-4 (22), and macrophage-colony stimulating factor (23).

The 167 amino acid leptin has a 21 amino acid N-terminal signal sequence that is cleaved during leptin maturation (1-3;16;24).  Vertebrate leptins have two conserved cysteine residues (Cys117 and Cys167 in mouse leptin) that form an intramolecular disulfide bond between the C-terminus and the beginning of the CD loop (17;25).  The function of the disulfide bond has been debated.  Initial studies reported that the disulfide bond was essential for folding and receptor binding (17).  However, an in vitro study on a mutant with mutations at the conserved cysteines did not exhibit changes in leptin function (25). In contrast, another in vitro study showed that mutations at either (or both) cysteines resulted in impaired leptin secretion and the formation of aggregates (26).  It was proposed that the discrepancies in the in vitro studies was due to the use of different expression systems (26): Imagawa et al. (25) studied mutant leptin purified from E. coli inclusion bodies; Boute et al. (26) studied leptin secretion in mammalian cells Three conserved leptin receptor (LepR; see the records for Business class, Cherub, and Well-upholstered) binding sites on leptin have been identified: site I is on the face of helix D and is proposed to bind the cytokine receptor homology 1 (CRH1) or CRH2 domain of the LepR, site II is composed of residues on the surface of helices A and C and binds the CRH2 domain of LepR, and site III is at the N-terminus of helix D at the interface of the N-terminus of helix D and the AB loop and binds the immunoglobulin-like domain of LepR (1;4;27;28). Binding site II is proposed to be the main high affinity binding site for receptor-ligand interaction (29-31), while site III is proposed to function in forming the active multimeric complex and activating the receptor (27;32).  Mutagenesis of mouse and human leptins in the proximity of binding site III have identified Tyr-140, Ser-141, and Thr-142 as essential for activation, but not binding, of leptin to LepR (27;32). In addition to the three binding sites in leptin, the highly conserved GLDFIP sequence at aa 38-43 in human leptin is required for LepR activation (4;33;34).

The potbelly mutation results in coding of a premature stop codon at amino acid 7 within the N-terminal signal peptide region (aa 1-21).

Expression/Localization

Lep mRNA is highly expressed in white adipose tissue (35), stomach, and liver (2;36-39). Lep is expressed at lower levels in brown adipose tissue, heart, placenta and fetal tissues (40;41), the pituitary gland (42;43), primary and secondary lymphoid organs (19), bone marrow, mammary epithelium, ovaries, skeletal muscle, and the brain in humans and other mammalian species [(44); reviewed in (4;7;16;45;46)].  Although expression of Lep has been verified in the rat brain, expression is not detected in the brain of the mouse (7;47).

Lep expression is regulated in fasting/feeding and diabetes several hormones (e.g., insulin (48-50), glucocorticoid (51;52), and adrenergic agents (35)) regulate Lep. Lep expression is also proportional to the size of adipose cells: smaller cells express less Lep mRNA (53).  It is proposed that changes in the cell wall and plasma membrane tension can initiate signaling to enhance Lep expression (53).

Leptin secretion into the bloodstream is mediated by changes in several factors [reviewed in (16)]. (i) The amount of leptin produced by the body is proportional to the amount of white adipose tissue in the body [(54); reviewed in (7)]. (ii) Fat distribution leads to differential leptin levels in that subcutaneous fat produces more leptin than omental (i.e., abdominal) fat (55). (iii) Sex hormones differentially regulate the levels of leptin, resulting in higher leptin levels in men, independent of adipose tissue levels [(56-58); reviewed in (16)]. Furthermore, leptin levels are the highest in women during the luteal (i.e., secretory) phase of the menstrual cycle when progesterone levels are the highest (59).  (iv) Leptin secretion exhibits a pulsatile release pattern (60) and there is an inverse relation between the rapidity of the leptin fluctuations in the plasma with those of adrenocorticotropic hormone and cortisol.  The amplitude of leptin pulses is greater in obese versus lean individuals [(60); reviewed in (16)]. (v) Leptin expression is regulated in a circadian-based manner; leptin is lowest between early afternoon and mid-afternoon and it is at its highest between midnight and early morning [(61;62); reviewed in (16)]. (vi) Leptin concentrations are low in fetuses and high in neonates, possibly to regulate different developmental processes (i.e., maintaining neural stem cells or progenitor cells in fetuses and regulating the differentiation of neurons in neonates) (63).

Leptin is transported across the blood-brain barrier via the short receptor form of the LepR (LepRa; see the record for Business class) and an unidentified receptor isoform localized to non-neuronal cells in the meninges, choroid plexus, and blood vessels [(64;65); reviewed in (7)].

Background

Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation. For a comprehensive review on leptin-associated signaling and functions please see the record for Business class. Table 1 summarizes the current knowledge of leptin-mediated functions.

Table 1.  Summary of leptin-associated functions [reviewed in (3;4;7;27)]

Function	Details	References
Regulation of energy expenditure, food intake, weight loss, and diabetes	Leptin acts on the hypothalamus to signal when the body has enough energy, subsequently inhibiting appetite  Leptin influences energy balance through the hypothalamic -pituitary-adrenal (HPA) and hypothalamic -pituitary-thyroid (HPT) axes Leptin stimulates corticotropin releasing hormone, which suppresses appetite Morbid obesity can lead to the development of type 2 diabetes Recombinant leptin produces weight loss in the Lepob/Lepob mouse	(1;66-74)
Promotion of linear growth	Leptin influences energy balance Leptin induces mitosis (e.g., chondrocytes of the epiphyseal growth plate) Leptin stimulates pituitary growth hormone	(75;76)
Promotes onset of puberty and the ovulatory cycle in mammals	Puberty is promoted via leptin-mediated action on mammalian target of rapamycin (mTOR) Rise in leptin levels precedes onset of puberty Human mutations can cause hypogonadotropic hypogonadism	(63;76-81)
Embryonic and fetal development	Lepob/Lepob mice are sterile; leptin supplementation rescues infertility phenotype Leptin regulates the levels of β3-integrin, IL-1, LIF, IL-1 receptor, and VEGF receptor 2 during implantation Leptin promotes oligodendroglial and cortical neuron development in the embryonic cerebral cortex Fetal plasma leptin concentration is correlated with weight, length, and head circumference at birth; maternal leptin concentration shows a negative correlation with fetal growth in humans	(63;82-86)
Neural development	Lepob/Lepob mice have reduced brain weight and DNA content; leptin treatment reverses the phenotype	(63;82;87)
Bone development, growth, and homeostasis	Low levels of leptin are linked to osteoporosis/stress fractures in women with hypothalamic amenorrhea Leptin deficiency leads to decreased bone formation	(16;88-93)
Lung development, function, and diseases	Leptin is expressed in fetal lung tissue; expression is enhanced during alveolar differentiation in rat lung fibroblasts Leptin is a stimulant of ventilation Leptin levels are decreased in patients with obstructive sleep apnea Leptin may regulate the infiltration and survival of inflammatory cells in the submucosa of chronic obstructive pulmonary disease (COPD)	(94-97)
Cardiac function	Leptin receptor-mediated activation of signal transducer and activator of transcription-3 (STAT3) mediates cardiac remodeling after injury and in heart failure Leptin acts as a growth factor in cardiac myocytes Increased plasma leptin levels is a potential independent risk factor for coronary heart disease	(98-105)
Immune function	Leptin enhances T-cell-mediated immune responses by signaling through the long form of the LepR on CD4+ T lymphocytes Leptin can shift T-cell responses toward a Th1 type, with increased secretion of pro-inflammatory cytokines interleukin-2 and interferon-γ and decreased interleukin-4 production Humans with congenital leptin deficiency have a much higher incidence of infection-related death during childhood Leptin induces the proliferation, differentiation, and function of hemopoietic cells	(14;106-110)
Regulates the development of autoimmune diseases	Lepob/Lepob mice show reduced experimentally induced colitis, arthritis, and experimental auto-immune encephalomyelitis	(111-116)
Promotes atherosclerosis	Lepob/Lepob mice appear to be resistant to diet-induced atherosclerosis	(83;116;117)
Thyroid function	Thyroid-releasing hormone is positively regulated by leptin	(68)
Stress response	Leptin blunts the rise of ACTH and corticosterone and inhibits glucocorticoid synthesis and secretion in the adrenal cortex	(118;119)
Induction of angiogenesis	In vivo, leptin induces neovascularization in corneas from normal rats, but not in corneas from fa/fa Zucker rats, which lack functional leptin receptors	(120)
Enhancement of wound healing	Excisional wounds treated with a neutralizing anti-leptin antibodies had reduced healing progression and wound closure and contraction were prevented	(121)
Cancer	Leptin is often overexpressed, along with the LepR, in tumor tissues Increased levels of leptin can be indicative of poor prognosis	(122-125)

In humans, mutations in LEP are linked to morbid obesity, with or without hypogonadism [OMIM: +164160; (1;79;126;127)].  Homozygosity in reported mutations [i.e., frameshift mutation at ΔG133 that leads to a premature stop codon (126), missense mutation R105W (79), and missense mutation at N103K (128)] result in an inability to produce/secrete leptin [reviewed in (1)].  Heterozygosity of a mutant leptin (frameshift ΔG133) can cause increased body weight (129).  In addition to obesity, patients with leptin deficiency can also exhibit many of the phenotypes listed in Table 1.  Administration of leptin to patients has been shown to treat and/or reverse several of the phenotypes [(130-132); reviewed in (16)].

Lep mouse models

The Lep^ob (ob) strain (MGI:1856424) has a nonsense mutation in Lep that results in coding of a premature stop codon at aa 105 (2); the mutant Lep mRNA is expressed 20-fold higher than wild-type animals although serum leptin levels are undetectable (3).  The Lep^ob/Lep^ob mouse is morbidly obese and is characterized by hyperinsulinemia, hyperglucocorticoidemia, hypothalamic hypothyroidism, defects in cell-mediated and humoral immunity [i.e., Thy 1.2-positive lymphocytes are reduced, lower plaque forming cell response, increase in natural killer cell activity, and an increase in antibody-dependent cell-mediated cytotoxicity (133)], impaired thermogenesis, hyperglycemia, insulin resistance, altered central nervous system activity, reduced metabolic rate of brown adipose tissue, infertility, and lethargy [(19;134-137); reviewed in (4;24)]. There are slight strain differences in the severity and course of the diabetes phenotype exhibited by the Lep^ob/Lep^ob mice. Upon treatment with leptin, female Lep^ob/Lep^ob mice can ovulate and give birth [(78); reviewed in (16)] due to the stimulation of secretion of luteinizing hormone (138). Studies have shown that Lep^ob/Lep^ob mice are resistant to actively and passively induced experimental autoimmune encephalomyelitis (EAE), a model of multiple sclerosis (19;139).  Following leptin administration, the Lep^ob/Lep^ob mice become susceptible to the disease (139).  Researchers determined that the resistance to EAE was due to a reduced proliferative response to myelin antigens and an increased IL-4 response; treatment with leptin converted the Th2 to a Th1-type cytokine response and the subsequent secretion of IFN-α and to an IgG1-to-IgG2a isotype shift switch (19). In addition, administration of leptin to wild-type animals promoted an increase in proinflammatory cytokines and IgG2a production, causing a more severe disease phenotype (19).

A second spontaneous mutation, Lep^ob-2J (MGI:1858048), has a retroviral-like transposon inserted into the first intron of Lep (140).  The insertion of the transposon leads to the production of chimeric RNAs in which the first exon of Lep is spliced to sequences in the insertion (140).  In this mutant, the mature Lep RNA is not synthesized (140). The Lep^ob-2J/ Lep^ob-2J mouse is phenotypically indistinguishable from the ob/ob strain.

A third mutant mouse model has an ENU-induced T-to-A mutation in exon 3 of Lep, resulting in a Val (V) to Glu (E) exchange at amino acid 145 (V145E) [MGI: 4880027; (1)]. This residue is in the N-terminal region of helix D, a domain that contains LepR binding site III.   The V145E mutation does not alter the binding of leptin to the LepR (1).  In contrast to the spontaneous models, the level of circulating leptin was increased in the V145E mice (1). Homozygous V145E mice share similar phenotypes to the spontaneous mutants mentioned above and they also exhibit adipocyte hypertrophy and hyperplasia as well as liver steatosis (i.e., fatty infiltration) (1).

Putative Mechanism

The phenotype of the potbelly mice mimic other Lep mouse models [see "Background", above; (1;2;140)] in that they exhibit morbid obesity.  Expression and secretion of Lep in the potbelly mice has not been examined. Other leptin-related phenotypes and functions (as seen in Table 1) have not been tested in potbelly.

Primers

PCR Primer
potbelly_pcr_F: CTCTTCCCAGGGGTACACATTTCAC
potbelly_pcr_R: CGATACTGGCAGTACAACTGAGCAG

Sequencing Primer
potbelly_seq_F: CAGGGGTACACATTTCACTAATC
potbelly_seq_R: CTGTATTTCAGCAGGCAGC

Genotyping

Potbelly genotyping is performed by PCR amplifying regions on Lep that contain the mutation. The PCR product is subsequently sequenced to detect the nucleotide change.

The following primers were used for PCR amplification and sequencing of Lep:

Primers for PCR amplification

LEP_F: 5’- CTCTTCCCAGGGGTACACATTTCAC -3’

LEP_R: 5’- CGATACTGGCAGTACAACTGAGCAG -3’

Primers for Sequencing

LEP_Seq_F: 5’- CAGGGGTACACATTTCACTAATC -3’

LEP_Seq_R: 5’- CTGTATTTCAGCAGGCAGC -3’

The following sequence of 574 nucleotides is amplified (Genbank genomic region NC_000072 for linear DNA sequence of Lep):  

ctcttcccag gggtacacat ttcactaatc taggttccat aatgaattgt ctttgacttt          

ggcaagatag tagcaagtta gggaagaaag cacattttat ccgtccacat cctatagcag      

gatggcagca ggaccattgg atggattcat attgggctct tgaaaagtgt cattcattct      

gtctgtaggt gcaagaagaa gaagatccca gggaggaaaa tgtgctggag acccctgtgt      

cggttcctgt ggctttggtc ctatctgtct tatgttcaag cagtgcctat ccagaaagtc      

caggatgaca ccaaaaccct catcaagacc attgtcacca ggatcaatga catttcacac      

acggtaggag tctcatgggg ggacaaagat gtaggactag aaccagagtc tgagaaacat      

gtcatgcacc tcctagaagc tgagagttta taagcctcga gtgtacatta tttctggtca      

tggctcttgt cactgctgcc tgctgaaata cagggctgag tggttccatt tctaaaccca      

gcatctagac tgctcagttg tactgccagt atcg

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is shown in red text.

References

  1. Hong, C. J., Tsai, P. J., Cheng, C. Y., Chou, C. K., Jheng, H. F., Chuang, Y. C., Yang, C. N., Lin, Y. T., Hsu, C. W., Cheng, I. H., Chen, S. Y., Tsai, S. J., Liou, Y. J., and Tsai, Y. S. (2010) ENU Mutagenesis Identifies Mice with Morbid Obesity and Severe Hyperinsulinemia Caused by a Novel Mutation in Leptin. PLoS One. 5, e15333.

  2. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994) Positional Cloning of the Mouse Obese Gene and its Human Homologue. Nature. 372, 425-432.

  3. Caro, J. F., Sinha, M. K., Kolaczynski, J. W., Zhang, P. L., and Considine, R. V. (1996) Leptin: The Tale of an Obesity Gene. Diabetes. 45, 1455-1462.

  4. Denver, R. J., Bonett, R. M., and Boorse, G. C. (2011) Evolution of Leptin Structure and Function. Neuroendocrinology. 94, 21-38.

  5. Kochan, Z., Karbowska, J., and Meissner, W. (2006) Leptin is Synthesized in the Liver and Adipose Tissue of the Dunlin (Calidris Alpina). Gen Comp Endocrinol. 148, 336-339.

  6. Gorissen, M., Bernier, N. J., Nabuurs, S. B., Flik, G., and Huising, M. O. (2009) Two Divergent Leptin Paralogues in Zebrafish (Danio Rerio) that Originate Early in Teleostean Evolution. J Endocrinol. 201, 329-339.

  7. Roubos, E. W., Dahmen, M., Kozicz, T., and Xu, L. (2012) Leptin and the Hypothalamo-Pituitary-Adrenal Stress Axis. Gen Comp Endocrinol. 177, 28-36.

  8. Huising, M. O., Kruiswijk, C. P., and Flik, G. (2006) Phylogeny and Evolution of Class-I Helical Cytokines. J Endocrinol. 189, 1-25.

  9. Zhang, Y., Wilsey, J. T., Frase, C. D., Matheny, M. M., Bender, B. S., Zolotukhin, S., and Scarpace, P. J. (2002) Peripheral but Not Central Leptin Prevents the Immunosuppression Associated with Hypoleptinemia in Rats. J Endocrinol. 174, 455-461.

  10. Khan, S. M., Hamnvik, O. P., Brinkoetter, M., and Mantzoros, C. S. (2012) Leptin as a Modulator of Neuroendocrine Function in Humans. Yonsei Med J. 53, 671-679.

  11. MacDougald, O. A., Hwang, C. S., Fan, H. Y., and Lane, M. D. (1995) Regulated Expression of the Obese Gene Product (Leptin) in White Adipose Tissue and 3T3-L1 Adipocytes. Proc Natl Acad Sci USA. 92, 9034-9037.

  12. Luque, R. M., Huang, Z. H., Shah, B., Mazzone, T., and Kineman, R. D. (2007) Effects of Leptin Replacement on Hypothalamic-Pituitary Growth Hormone Axis Function and Circulating Ghrelin Levels in ob/ob Mice. Am J Physiol Endocrinol Metab. 292, E891-9.

  13. Costa, A., Poma, A., Martignoni, E., Nappi, G., Ur, E., and Grossman, A. (1997) Stimulation of Corticotrophin-Releasing Hormone Release by the Obese (Ob) Gene Product, Leptin, from Hypothalamic Explants. Neuroreport. 8, 1131-1134.

  14. Licinio, J., Mantzoros, C., Negrao, A. B., Cizza, G., Wong, M. L., Bongiorno, P. B., Chrousos, G. P., Karp, B., Allen, C., Flier, J. S., and Gold, P. W. (1997) Human Leptin Levels are Pulsatile and Inversely Related to Pituitary-Adrenal Function. Nat Med. 3, 575-579.

  15. Ahima, R. S., Prabakaran, D., Mantzoros, C., Qu, D., Lowell, B., Maratos-Flier, E., and Flier, J. S. (1996) Role of Leptin in the Neuroendocrine Response to Fasting. Nature. 382, 250-252.

  16. Procaccini, C., Jirillo, E., and Matarese, G. (2012) Leptin as an Immunomodulator. Mol Aspects Med. 33, 35-45.

  17. Coppari, R., and Bjorbaek, C. (2012) Leptin Revisited: Its Mechanism of Action and Potential for Treating Diabetes. Nat Rev Drug Discov. 11, 692-708.

  18. Zhang, F., Basinski, M. B., Beals, J. M., Briggs, S. L., Churgay, L. M., Clawson, D. K., DiMarchi, R. D., Furman, T. C., Hale, J. E., Hsiung, H. M., Schoner, B. E., Smith, D. P., Zhang, X. Y., Wery, J. P., and Schevitz, R. W. (1997) Crystal Structure of the Obese Protein Leptin-E100. Nature. 387, 206-209.

  19. Kline, A. D., Becker, G. W., Churgay, L. M., Landen, B. E., Martin, D. K., Muth, W. L., Rathnachalam, R., Richardson, J. M., Schoner, B., Ulmer, M., and Hale, J. E. (1997) Leptin is a Four-Helix Bundle: Secondary Structure by NMR. FEBS Lett. 407, 239-242.

  20. Matarese, G., Moschos, S., and Mantzoros, C. S. (2005) Leptin in Immunology. J Immunol. 174, 3137-3142.

  21. Murzin, A. G., Brenner, S. E., Hubbard, T., and Chothia, C. (1995) SCOP: A Structural Classification of Proteins Database for the Investigation of Sequences and Structures. J Mol Biol. 247, 536-540.

  22. Brandhuber, B. J., Boone, T., Kenney, W. C., and McKay, D. B. (1987) Crystals and a Low Resolution Structure of Interleukin-2. J Biol Chem. 262, 12306-12308.

  23. Garrett, D. S., Powers, R., March, C. J., Frieden, E. A., Clore, G. M., and Gronenborn, A. M. (1992) Determination of the Secondary Structure and Folding Topology of Human Interleukin-4 using Three-Dimensional Heteronuclear Magnetic Resonance Spectroscopy. Biochemistry. 31, 4347-4353.

  24. Pandit, J., Bohm, A., Jancarik, J., Halenbeck, R., Koths, K., and Kim, S. H. (1992) Three-Dimensional Structure of Dimeric Human Recombinant Macrophage Colony-Stimulating Factor. Science. 258, 1358-1362.

  25. Peelman, F., Van Beneden, K., Zabeau, L., Iserentant, H., Ulrichts, P., Defeau, D., Verhee, A., Catteeuw, D., Elewaut, D., and Tavernier, J. (2004) Mapping of the Leptin Binding Sites and Design of a Leptin Antagonist. J Biol Chem. 279, 41038-41046.

  26. Zhang, F., Chen, Y., Heiman, M., and Dimarchi, R. (2005) Leptin: Structure, Function and Biology. Vitam Horm. 71, 345-372.

  27. Zabeau, L., Defeau, D., Van der Heyden, J., Iserentant, H., Vandekerckhove, J., and Tavernier, J. (2004) Functional Analysis of Leptin Receptor Activation using a Janus kinase/signal Transducer and Activator of Transcription Complementation Assay. Mol Endocrinol. 18, 150-161.

  28. Sandowski, Y., Raver, N., Gussakovsky, E. E., Shochat, S., Dym, O., Livnah, O., Rubinstein, M., Krishna, R., and Gertler, A. (2002) Subcloning, Expression, Purification, and Characterization of Recombinant Human Leptin-Binding Domain. J Biol Chem. 277, 46304-46309.

  29. Fong, T. M., Huang, R. R., Tota, M. R., Mao, C., Smith, T., Varnerin, J., Karpitskiy, V. V., Krause, J. E., and Van Der Ploeg, L. H. (1998) Localization of Leptin Binding Domain in the Leptin Receptor. Mol Pharmacol. 53, 234-240.

  30. Niv-Spector, L., Gonen-Berger, D., Gourdou, I., Biener, E., Gussakovsky, E. E., Benomar, Y., Ramanujan, K. V., Taouis, M., Herman, B., Callebaut, I., Djiane, J., and Gertler, A. (2005) Identification of the Hydrophobic Strand in the A-B Loop of Leptin as Major Binding Site III: Implications for Large-Scale Preparation of Potent Recombinant Human and Ovine Leptin Antagonists. Biochem J. 391, 221-230.

  31. Gertler, A. (2006) Development of Leptin Antagonists and their Potential use in Experimental Biology and Medicine. Trends Endocrinol Metab. 17, 372-378.

  32. Elinav, E., Niv-Spector, L., Katz, M., Price, T. O., Ali, M., Yacobovitz, M., Solomon, G., Reicher, S., Lynch, J. L., Halpern, Z., Banks, W. A., and Gertler, A. (2009) Pegylated Leptin Antagonist is a Potent Orexigenic Agent: Preparation and Mechanism of Activity. Endocrinology. 150, 3083-3091.

  33. Imagawa, K., Numata, Y., Katsuura, G., Sakaguchi, I., Morita, A., Kikuoka, S., Matumoto, Y., Tsuji, T., Tamaki, M., Sasakura, K., Teraoka, H., Hosoda, K., Ogawa, Y., and Nakao, K. (1998) Structure-Function Studies of Human Leptin. J Biol Chem. 273, 35245-35249.

  34. Boute, N., Zilberfarb, V., Camoin, L., Bonnafous, S., Le Marchand-Brustel, Y., and Issad, T. (2004) The Formation of an Intrachain Disulfide Bond in the Leptin Protein is Necessary for Efficient Leptin Secretion. Biochimie. 86, 351-356.

  35. Trayhurn, P., Duncan, J. S., Hoggard, N., and Rayner, D. V. (1998) Regulation of Leptin Production: A Dominant Role for the Sympathetic Nervous System? Proc Nutr Soc. 57, 413-419.

  36. Potter, J. J., Womack, L., Mezey, E., and Anania, F. A. (1998) Transdifferentiation of Rat Hepatic Stellate Cells Results in Leptin Expression. Biochem Biophys Res Commun. 244, 178-182.

  37. Bado, A., Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J. P., Bortoluzzi, M. N., Moizo, L., Lehy, T., Guerre-Millo, M., Le Marchand-Brustel, Y., and Lewin, M. J. (1998) The Stomach is a Source of Leptin. Nature. 394, 790-793.

  38. Friedman, J. M. (1998) Leptin, Leptin Receptors, and the Control of Body Weight. Nutr Rev. 56, s38-46; discussion s54-75.

  39. Ikejima, K., Takei, Y., Honda, H., Hirose, M., Yoshikawa, M., Zhang, Y. J., Lang, T., Fukuda, T., Yamashina, S., Kitamura, T., and Sato, N. (2002) Leptin Receptor-Mediated Signaling Regulates Hepatic Fibrogenesis and Remodeling of Extracellular Matrix in the Rat. Gastroenterology. 122, 1399-1410.

  40. Green, E. D., Maffei, M., Braden, V. V., Proenca, R., DeSilva, U., Zhang, Y., Chua, S. C.,Jr, Leibel, R. L., Weissenbach, J., and Friedman, J. M. (1995) The Human Obese (OB) Gene: RNA Expression Pattern and Mapping on the Physical, Cytogenetic, and Genetic Maps of Chromosome 7. Genome Res. 5, 5-12.

  41. Hoggard, N., Hunter, L., Duncan, J. S., Williams, L. M., Trayhurn, P., and Mercer, J. G. (1997) Leptin and Leptin Receptor mRNA and Protein Expression in the Murine Fetus and Placenta. Proc Natl Acad Sci U S A. 94, 11073-11078.

  42. Clement, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J. M., Basdevant, A., Bougneres, P., Lebouc, Y., Froguel, P., and Guy-Grand, B. (1998) A Mutation in the Human Leptin Receptor Gene Causes Obesity and Pituitary Dysfunction. Nature. 392, 398-401.

  43. Tipsmark, C. K., Strom, C. N., Bailey, S. T., and Borski, R. J. (2008) Leptin Stimulates Pituitary Prolactin Release through an Extracellular Signal-Regulated Kinase-Dependent Pathway. J Endocrinol. 196, 275-281.

  44. Harvey, J. (2003) Leptin: A Multifaceted Hormone in the Central Nervous System. Mol Neurobiol. 28, 245-258.

  45. Margetic, S., Gazzola, C., Pegg, G. G., and Hill, R. A. (2002) Leptin: A Review of its Peripheral Actions and Interactions. Int J Obes Relat Metab Disord. 26, 1407-1433.

  46. Morash, B., Li, A., Murphy, P. R., Wilkinson, M., and Ur, E. (1999) Leptin Gene Expression in the Brain and Pituitary Gland. Endocrinology. 140, 5995-5998.

  47. Del Bianco-Borges, B., Cabral, F. J., and Franci, C. R. (2010) Co-Expression of Leptin and Oestrogen Receptors in the Preoptic-Hypothalamic Area. J Neuroendocrinol. 22, 996-1003.

  48. Cusin, I., Sainsbury, A., Doyle, P., Rohner-Jeanrenaud, F., and Jeanrenaud, B. (1995) The Ob Gene and Insulin. A Relationship Leading to Clues to the Understanding of Obesity. Diabetes. 44, 1467-1470.

  49. Saladin, R., De Vos, P., Guerre-Millo, M., Leturque, A., Girard, J., Staels, B., and Auwerx, J. (1995) Transient Increase in Obese Gene Expression After Food Intake Or Insulin Administration. Nature. 377, 527-529.

  50. Kolaczynski, J. W., Nyce, M. R., Considine, R. V., Boden, G., Nolan, J. J., Henry, R., Mudaliar, S. R., Olefsky, J., and Caro, J. F. (1996) Acute and Chronic Effects of Insulin on Leptin Production in Humans: Studies in Vivo and in Vitro. Diabetes. 45, 699-701.

  51. De Vos, P., Saladin, R., Auwerx, J., and Staels, B. (1995) Induction of Ob Gene Expression by Corticosteroids is Accompanied by Body Weight Loss and Reduced Food Intake. J Biol Chem. 270, 15958-15961.

  52. Slieker, L. J., Sloop, K. W., Surface, P. L., Kriauciunas, A., LaQuier, F., Manetta, J., Bue-Valleskey, J., and Stephens, T. W. (1996) Regulation of Expression of Ob mRNA and Protein by Glucocorticoids and cAMP. J Biol Chem. 271, 5301-5304.

  53. Hamilton, B. S., Paglia, D., Kwan, A. Y., and Deitel, M. (1995) Increased Obese mRNA Expression in Omental Fat Cells from Massively Obese Humans. Nat Med. 1, 953-956.

  54. Scherer, T., and Buettner, C. (2011) Yin and Yang of Hypothalamic Insulin and Leptin Signaling in Regulating White Adipose Tissue Metabolism. Rev Endocr Metab Disord. 12, 235-243.

  55. Montague, C. T., Prins, J. B., Sanders, L., Digby, J. E., and O'Rahilly, S. (1997) Depot- and Sex-Specific Differences in Human Leptin mRNA Expression: Implications for the Control of Regional Fat Distribution. Diabetes. 46, 342-347.

  56. Saad, M. F., Damani, S., Gingerich, R. L., Riad-Gabriel, M. G., Khan, A., Boyadjian, R., Jinagouda, S. D., el-Tawil, K., Rude, R. K., and Kamdar, V. (1997) Sexual Dimorphism in Plasma Leptin Concentration. J Clin Endocrinol Metab. 82, 579-584.

  57. Shimizu, H., Shimomura, Y., Nakanishi, Y., Futawatari, T., Ohtani, K., Sato, N., and Mori, M. (1997) Estrogen Increases in Vivo Leptin Production in Rats and Human Subjects. J Endocrinol. 154, 285-292.

  58. Roemmich, J. N., Clark, P. A., Berr, S. S., Mai, V., Mantzoros, C. S., Flier, J. S., Weltman, A., and Rogol, A. D. (1998) Gender Differences in Leptin Levels during Puberty are Related to the Subcutaneous Fat Depot and Sex Steroids. Am J Physiol. 275, E543-51.

  59. Asimakopoulos, B., Milousis, A., Gioka, T., Kabouromiti, G., Gianisslis, G., Troussa, A., Simopoulou, M., Katergari, S., Tripsianis, G., and Nikolettos, N. (2009) Serum Pattern of Circulating Adipokines Throughout the Physiological Menstrual Cycle. Endocr J. 56, 425-433.

  60. Licinio, J., Mantzoros, C., Negrao, A. B., Cizza, G., Wong, M. L., Bongiorno, P. B., Chrousos, G. P., Karp, B., Allen, C., Flier, J. S., and Gold, P. W. (1997) Human Leptin Levels are Pulsatile and Inversely Related to Pituitary-Adrenal Function. Nat Med. 3, 575-579.

  61. Shea, S. A., Hilton, M. F., Orlova, C., Ayers, R. T., and Mantzoros, C. S. (2005) Independent Circadian and sleep/wake Regulation of Adipokines and Glucose in Humans. J Clin Endocrinol Metab. 90, 2537-2544.

  62. Sinha, M. K., Ohannesian, J. P., Heiman, M. L., Kriauciunas, A., Stephens, T. W., Magosin, S., Marco, C., and Caro, J. F. (1996) Nocturnal Rise of Leptin in Lean, Obese, and Non-Insulin-Dependent Diabetes Mellitus Subjects. J Clin Invest. 97, 1344-1347.

  63. Udagawa, J., Hatta, T., Hashimoto, R., and Otani, H. (2007) Roles of Leptin in Prenatal and Perinatal Brain Development. Congenit Anom (Kyoto). 47, 77-83.

  64. Kastin, A. J., Pan, W., Maness, L. M., Koletsky, R. J., and Ernsberger, P. (1999) Decreased Transport of Leptin Across the Blood-Brain Barrier in Rats Lacking the Short Form of the Leptin Receptor. Peptides. 20, 1449-1453.

  65. Price, T. O., Farr, S. A., Yi, X., Vinogradov, S., Batrakova, E., Banks, W. A., and Kabanov, A. V. (2010) Transport Across the Blood-Brain Barrier of Pluronic Leptin. J Pharmacol Exp Ther. 333, 253-263.

  66. Ahima, R. S., Saper, C. B., Flier, J. S., and Elmquist, J. K. (2000) Leptin Regulation of Neuroendocrine Systems. Front Neuroendocrinol. 21, 263-307.

  67. Elmquist, J. K., Coppari, R., Balthasar, N., Ichinose, M., and Lowell, B. B. (2005) Identifying Hypothalamic Pathways Controlling Food Intake, Body Weight, and Glucose Homeostasis. J Comp Neurol. 493, 63-71.

  68. Ghamari-Langroudi, M., Vella, K. R., Srisai, D., Sugrue, M. L., Hollenberg, A. N., and Cone, R. D. (2010) Regulation of Thyrotropin-Releasing Hormone-Expressing Neurons in Paraventricular Nucleus of the Hypothalamus by Signals of Adiposity. Mol Endocrinol. 24, 2366-2381.

  69. Cohen, M. M.,Jr. (2006) Role of Leptin in Regulating Appetite, Neuroendocrine Function, and Bone Remodeling. Am J Med Genet A. 140, 515-524.

  70. Woods, A. J., and Stock, M. J. (1996) Leptin Activation in Hypothalamus. Nature. 381, 745.

  71. Mastorakos, G., and Zapanti, E. (2004) The Hypothalamic-Pituitary-Adrenal Axis in the Neuroendocrine Regulation of Food Intake and Obesity: The Role of Corticotropin Releasing Hormone. Nutr Neurosci. 7, 271-280.

  72. Glowa, J. R., and Gold, P. W. (1991) Corticotropin Releasing Hormone Produces Profound Anorexigenic Effects in the Rhesus Monkey. Neuropeptides. 18, 55-61.

  73. Halaas, J. L., Gajiwala, K. S., Maffei, M., Cohen, S. L., Chait, B. T., Rabinowitz, D., Lallone, R. L., Burley, S. K., and Friedman, J. M. (1995) Weight-Reducing Effects of the Plasma Protein Encoded by the Obese Gene. Science. 269, 543-546.

  74. Weigle, D. S., Bukowski, T. R., Foster, D. C., Holderman, S., Kramer, J. M., Lasser, G., Lofton-Day, C. E., Prunkard, D. E., Raymond, C., and Kuijper, J. L. (1995) Recombinant Ob Protein Reduces Feeding and Body Weight in the ob/ob Mouse. J Clin Invest. 96, 2065-2070.

  75. Gat-Yablonski, G., and Phillip, M. (2008) Leptin and Regulation of Linear Growth. Curr Opin Clin Nutr Metab Care. 11, 303-308.

  76. Ong, K. K., Ahmed, M. L., and Dunger, D. B. (1999) The Role of Leptin in Human Growth and Puberty. Acta Paediatr Suppl. 88, 95-98.

  77. Roa, J., and Tena-Sempere, M. (2010) Energy Balance and Puberty Onset: Emerging Role of Central mTOR Signaling. Trends Endocrinol Metab. 21, 519-528.

  78. Chehab, F. F., Lim, M. E., and Lu, R. (1996) Correction of the Sterility Defect in Homozygous Obese Female Mice by Treatment with the Human Recombinant Leptin. Nat Genet. 12, 318-320.

  79. Strobel, A., Issad, T., Camoin, L., Ozata, M., and Strosberg, A. D. (1998) A Leptin Missense Mutation Associated with Hypogonadism and Morbid Obesity. Nat Genet. 18, 213-215.

  80. Mantzoros, C. S., Flier, J. S., and Rogol, A. D. (1997) A Longitudinal Assessment of Hormonal and Physical Alterations during Normal Puberty in Boys. V. Rising Leptin Levels may Signal the Onset of Puberty. J Clin Endocrinol Metab. 82, 1066-1070.

  81. Ahima, R. S., Dushay, J., Flier, S. N., Prabakaran, D., and Flier, J. S. (1997) Leptin Accelerates the Onset of Puberty in Normal Female Mice. J Clin Invest. 99, 391-395.

  82. Udagawa, J., Hashimoto, R., Suzuki, H., Hatta, T., Sotomaru, Y., Hioki, K., Kagohashi, Y., Nomura, T., Minami, Y., and Otani, H. (2006) The Role of Leptin in the Development of the Cerebral Cortex in Mouse Embryos. Endocrinology. 147, 647-658.

  83. Yen, T. T., Allan, J. A., Pearson, D. V., and Schinitsky, M. R. (1977) Dissociation of Obesity, Hypercholesterolemia and Diabetes from Atherosclerosis in ob/ob Mice. Experientia. 33, 995-996.

  84. Ramos, M. P., Rueda, B. R., Leavis, P. C., and Gonzalez, R. R. (2005) Leptin Serves as an Upstream Activator of an Obligatory Signaling Cascade in the Embryo-Implantation Process. Endocrinology. 146, 694-701.

  85. Lepercq, J., Challier, J. C., Guerre-Millo, M., Cauzac, M., Vidal, H., and Hauguel-de Mouzon, S. (2001) Prenatal Leptin Production: Evidence that Fetal Adipose Tissue Produces Leptin. J Clin Endocrinol Metab. 86, 2409-2413.

  86. Ong, K. K., Ahmed, M. L., Sherriff, A., Woods, K. A., Watts, A., Golding, J., and Dunger, D. B. (1999) Cord Blood Leptin is Associated with Size at Birth and Predicts Infancy Weight Gain in Humans. ALSPAC Study Team. Avon Longitudinal Study of Pregnancy and Childhood. J Clin Endocrinol Metab. 84, 1145-1148.

  87. Steppan, C. M., and Swick, A. G. (1999) A Role for Leptin in Brain Development. Biochem Biophys Res Commun. 256, 600-602.

  88. Steppan, C. M., Crawford, D. T., Chidsey-Frink, K. L., Ke, H., and Swick, A. G. (2000) Leptin is a Potent Stimulator of Bone Growth in ob/ob Mice. Regul Pept. 92, 73-78.

  89. Karsenty, G., and Oury, F. (2010) The Central Regulation of Bone Mass, the First Link between Bone Remodeling and Energy Metabolism. J Clin Endocrinol Metab. 95, 4795-4801.

  90. Chan, J. L., and Mantzoros, C. S. (2005) Role of Leptin in Energy-Deprivation States: Normal Human Physiology and Clinical Implications for Hypothalamic Amenorrhoea and Anorexia Nervosa. Lancet. 366, 74-85.

  91. Miller, K. K., Parulekar, M. S., Schoenfeld, E., Anderson, E., Hubbard, J., Klibanski, A., and Grinspoon, S. K. (1998) Decreased Leptin Levels in Normal Weight Women with Hypothalamic Amenorrhea: The Effects of Body Composition and Nutritional Intake. J Clin Endocrinol Metab. 83, 2309-2312.

  92. Ducy, P., Amling, M., Takeda, S., Priemel, M., Schilling, A. F., Beil, F. T., Shen, J., Vinson, C., Rueger, J. M., and Karsenty, G. (2000) Leptin Inhibits Bone Formation through a Hypothalamic Relay: A Central Control of Bone Mass. Cell. 100, 197-207.

  93. Hamrick, M. W. (2004) Leptin, Bone Mass, and the Thrifty Phenotype. J Bone Miner Res. 19, 1607-1611.

  94. Malli, F., Papaioannou, A. I., Gourgoulianis, K. I., and Daniil, Z. (2010) The Role of Leptin in the Respiratory System: An Overview. Respir Res. 11, 152.

  95. Torday, J. S., Sun, H., Wang, L., Torres, E., Sunday, M. E., and Rubin, L. P. (2002) Leptin Mediates the Parathyroid Hormone-Related Protein Paracrine Stimulation of Fetal Lung Maturation. Am J Physiol Lung Cell Mol Physiol. 282, L405-10.

  96. Ip, M. S., Lam, K. S., Ho, C., Tsang, K. W., and Lam, W. (2000) Serum Leptin and Vascular Risk Factors in Obstructive Sleep Apnea. Chest. 118, 580-586.

  97. Bruno, A., Chanez, P., Chiappara, G., Siena, L., Giammanco, S., Gjomarkaj, M., Bonsignore, G., Bousquet, J., and Vignola, A. M. (2005) Does Leptin Play a Cytokine-Like Role within the Airways of COPD Patients? Eur Respir J. 26, 398-405.

  98. McGaffin, K. R., Sun, C. K., Rager, J. J., Romano, L. C., Zou, B., Mathier, M. A., O'Doherty, R. M., McTiernan, C. F., and O'Donnell, C. P. (2008) Leptin Signalling Reduces the Severity of Cardiac Dysfunction and Remodelling After Chronic Ischaemic Injury. Cardiovasc Res. 77, 54-63.

  99. Banks, A. S., Davis, S. M., Bates, S. H., and Myers, M. G.,Jr. (2000) Activation of Downstream Signals by the Long Form of the Leptin Receptor. J Biol Chem. 275, 14563-14572.

  100. Ren, J. (2004) Leptin and Hyperleptinemia - from Friend to Foe for Cardiovascular Function. J Endocrinol. 181, 1-10.

  101. Abe, Y., Ono, K., Kawamura, T., Wada, H., Kita, T., Shimatsu, A., and Hasegawa, K. (2007) Leptin Induces Elongation of Cardiac Myocytes and Causes Eccentric Left Ventricular Dilatation with Compensation. Am J Physiol Heart Circ Physiol. 292, H2387-96.

  102. Paolisso, G., Tagliamonte, M. R., Galderisi, M., Zito, G. A., Petrocelli, A., Carella, C., de Divitiis, O., and Varricchio, M. (1999) Plasma Leptin Level is Associated with Myocardial Wall Thickness in Hypertensive Insulin-Resistant Men. Hypertension. 34, 1047-1052.

  103. Perego, L., Pizzocri, P., Corradi, D., Maisano, F., Paganelli, M., Fiorina, P., Barbieri, M., Morabito, A., Paolisso, G., Folli, F., and Pontiroli, A. E. (2005) Circulating Leptin Correlates with Left Ventricular Mass in Morbid (Grade III) Obesity before and After Weight Loss Induced by Bariatric Surgery: A Potential Role for Leptin in Mediating Human Left Ventricular Hypertrophy. J Clin Endocrinol Metab. 90, 4087-4093.

  104. Schulze, P. C., Kratzsch, J., Linke, A., Schoene, N., Adams, V., Gielen, S., Erbs, S., Moebius-Winkler, S., and Schuler, G. (2003) Elevated Serum Levels of Leptin and Soluble Leptin Receptor in Patients with Advanced Chronic Heart Failure. Eur J Heart Fail. 5, 33-40.

  105. Shek, E. W., Brands, M. W., and Hall, J. E. (1998) Chronic Leptin Infusion Increases Arterial Pressure. Hypertension. 31, 409-414.

  106. Procaccini, C., Lourenco, E. V., Matarese, G., and La Cava, A. (2009) Leptin Signaling: A Key Pathway in Immune Responses. Curr Signal Transduct Ther. 4, 22-30.

  107. Lord, G. M., Matarese, G., Howard, J. K., Baker, R. J., Bloom, S. R., and Lechler, R. I. (1998) Leptin Modulates the T-Cell Immune Response and Reverses Starvation-Induced Immunosuppression. Nature. 394, 897-901.

  108. Martin-Romero, C., Santos-Alvarez, J., Goberna, R., and Sanchez-Margalet, V. (2000) Human Leptin Enhances Activation and Proliferation of Human Circulating T Lymphocytes. Cell Immunol. 199, 15-24.

  109. Ozata, M., Ozdemir, I. C., and Licinio, J. (1999) Human Leptin Deficiency Caused by a Missense Mutation: Multiple Endocrine Defects, Decreased Sympathetic Tone, and Immune System Dysfunction Indicate New Targets for Leptin Action, Greater Central than Peripheral Resistance to the Effects of Leptin, and Spontaneous Correction of Leptin-Mediated Defects. J Clin Endocrinol Metab. 84, 3686-3695.

  110. Gainsford, T., Willson, T. A., Metcalf, D., Handman, E., McFarlane, C., Ng, A., Nicola, N. A., Alexander, W. S., and Hilton, D. J. (1996) Leptin can Induce Proliferation, Differentiation, and Functional Activation of Hemopoietic Cells. Proc Natl Acad Sci U S A. 93, 14564-14568.

  111. Matarese, G., Sanna, V., Di Giacomo, A., Lord, G. M., Howard, J. K., Bloom, S. R., Lechler, R. I., Fontana, S., and Zappacosta, S. (2001) Leptin Potentiates Experimental Autoimmune Encephalomyelitis in SJL Female Mice and Confers Susceptibility to Males. Eur J Immunol. 31, 1324-1332.

  112. Matarese, G., Sanna, V., Lechler, R. I., Sarvetnick, N., Fontana, S., Zappacosta, S., and La Cava, A. (2002) Leptin Accelerates Autoimmune Diabetes in Female NOD Mice. Diabetes. 51, 1356-1361.

  113. Tarzi, R. M., Cook, H. T., Jackson, I., Pusey, C. D., and Lord, G. M. (2004) Leptin-Deficient Mice are Protected from Accelerated Nephrotoxic Nephritis. Am J Pathol. 164, 385-390.

  114. Siegmund, B., Lehr, H. A., and Fantuzzi, G. (2002) Leptin: A Pivotal Mediator of Intestinal Inflammation in Mice. Gastroenterology. 122, 2011-2025.

  115. Busso, N., So, A., Chobaz-Peclat, V., Morard, C., Martinez-Soria, E., Talabot-Ayer, D., and Gabay, C. (2002) Leptin Signaling Deficiency Impairs Humoral and Cellular Immune Responses and Attenuates Experimental Arthritis. J Immunol. 168, 875-882.

  116. Peelman, F., Waelput, W., Iserentant, H., Lavens, D., Eyckerman, S., Zabeau, L., and Tavernier, J. (2004) Leptin: Linking Adipocyte Metabolism with Cardiovascular and Autoimmune Diseases. Prog Lipid Res. 43, 283-301.

  117. Correia, M. L., and Haynes, W. G. (2004) Leptin, Obesity and Cardiovascular Disease. Curr Opin Nephrol Hypertens. 13, 215-223.

  118. Ahima, R. S., and Osei, S. Y. (2004) Leptin Signaling. Physiol Behav. 81, 223-241.

  119. Heiman, M. L., Ahima, R. S., Craft, L. S., Schoner, B., Stephens, T. W., and Flier, J. S. (1997) Leptin Inhibition of the Hypothalamic-Pituitary-Adrenal Axis in Response to Stress. Endocrinology. 138, 3859-3863.

  120. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G., Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B., Polverini, P. J., and Flores-Riveros, J. R. (1998) Biological Action of Leptin as an Angiogenic Factor. Science. 281, 1683-1686.

  121. Murad, A., Nath, A. K., Cha, S. T., Demir, E., Flores-Riveros, J., and Sierra-Honigmann, M. R. (2003) Leptin is an autocrine/paracrine Regulator of Wound Healing. FASEB J. 17, 1895-1897.

  122. Ishikawa, M., Kitayama, J., and Nagawa, H. (2004) Enhanced Expression of Leptin and Leptin Receptor (OB-R) in Human Breast Cancer. Clin Cancer Res. 10, 4325-4331.

  123. Garofalo, C., Koda, M., Cascio, S., Sulkowska, M., Kanczuga-Koda, L., Golaszewska, J., Russo, A., Sulkowski, S., and Surmacz, E. (2006) Increased Expression of Leptin and the Leptin Receptor as a Marker of Breast Cancer Progression: Possible Role of Obesity-Related Stimuli. Clin Cancer Res. 12, 1447-1453.

  124. Uddin, S., Hussain, A. R., Siraj, A. K., Khan, O. S., Bavi, P. P., and Al-Kuraya, K. S. (2011) Role of Leptin and its Receptors in the Pathogenesis of Thyroid Cancer. Int J Clin Exp Pathol. 4, 637-643.

  125. Wang, S. N., Lee, K. T., and Ker, C. G. (2010) Leptin in Hepatocellular Carcinoma. World J Gastroenterol. 16, 5801-5809.

  126. Montague, C. T., Farooqi, I. S., Whitehead, J. P., Soos, M. A., Rau, H., Wareham, N. J., Sewter, C. P., Digby, J. E., Mohammed, S. N., Hurst, J. A., Cheetham, C. H., Earley, A. R., Barnett, A. H., Prins, J. B., and O'Rahilly, S. (1997) Congenital Leptin Deficiency is Associated with Severe Early-Onset Obesity in Humans. Nature. 387, 903-908.

  127. Strosberg, A. D., and Issad, T. (1999) The Involvement of Leptin in Humans Revealed by Mutations in Leptin and Leptin Receptor Genes. Trends Pharmacol Sci. 20, 227-230.

  128. Mazen, I., El-Gammal, M., Abdel-Hamid, M., and Amr, K. (2009) A Novel Homozygous Missense Mutation of the Leptin Gene (N103K) in an Obese Egyptian Patient. Mol Genet Metab. 97, 305-308.

  129. Farooqi, I. S., Keogh, J. M., Kamath, S., Jones, S., Gibson, W. T., Trussell, R., Jebb, S. A., Lip, G. Y., and O'Rahilly, S. (2001) Partial Leptin Deficiency and Human Adiposity. Nature. 414, 34-35.

  130. Farooqi, I. S., Matarese, G., Lord, G. M., Keogh, J. M., Lawrence, E., Agwu, C., Sanna, V., Jebb, S. A., Perna, F., Fontana, S., Lechler, R. I., DePaoli, A. M., and O'Rahilly, S. (2002) Beneficial Effects of Leptin on Obesity, T Cell Hyporesponsiveness, and neuroendocrine/metabolic Dysfunction of Human Congenital Leptin Deficiency. J Clin Invest. 110, 1093-1103.

  131. Farooqi, I. S., Jebb, S. A., Langmack, G., Lawrence, E., Cheetham, C. H., Prentice, A. M., Hughes, I. A., McCamish, M. A., and O'Rahilly, S. (1999) Effects of Recombinant Leptin Therapy in a Child with Congenital Leptin Deficiency. N Engl J Med. 341, 879-884.

  132. Licinio, J., Caglayan, S., Ozata, M., Yildiz, B. O., de Miranda, P. B., O'Kirwan, F., Whitby, R., Liang, L., Cohen, P., Bhasin, S., Krauss, R. M., Veldhuis, J. D., Wagner, A. J., DePaoli, A. M., McCann, S. M., and Wong, M. L. (2004) Phenotypic Effects of Leptin Replacement on Morbid Obesity, Diabetes Mellitus, Hypogonadism, and Behavior in Leptin-Deficient Adults. Proc Natl Acad Sci U S A. 101, 4531-4536.

  133. Chandra, R. K. (1980) Cell-Mediated Immunity in Genetically Obese C57BL/6J ob/ob) Mice. Am J Clin Nutr. 33, 13-16.

  134. INGALLS, A. M., DICKIE, M. M., and SNELL, G. D. (1950) Obese, a New Mutation in the House Mouse. J Hered. 41, 317-318.

  135. Bray, G. A., and York, D. A. (1979) Hypothalamic and Genetic Obesity in Experimental Animals: An Autonomic and Endocrine Hypothesis. Physiol Rev. 59, 719-809.

  136. Bray, G. A., York, D. A., and Fisler, J. S. (1989) Experimental Obesity: A Homeostatic Failure due to Defective Nutrient Stimulation of the Sympathetic Nervous System. Vitam Horm. 45, 1-125.

  137. van der Kroon, P. H., Boldewijn, H., and Langeveld-Soeter, N. (1982) Congenital Hypothyroidism in Latent Obese (ob/ob) Mice. Int J Obes. 6, 83-90.

  138. Yu, W. H., Kimura, M., Walczewska, A., Karanth, S., and McCann, S. M. (1997) Role of Leptin in Hypothalamic-Pituitary Function. Proc Natl Acad Sci U S A. 94, 1023-1028.

  139. Matarese, G., Di Giacomo, A., Sanna, V., Lord, G. M., Howard, J. K., Di Tuoro, A., Bloom, S. R., Lechler, R. I., Zappacosta, S., and Fontana, S. (2001) Requirement for Leptin in the Induction and Progression of Autoimmune Encephalomyelitis. J Immunol. 166, 5909-5916.

  140. Moon, B. C., and Friedman, J. M. (1997) The Molecular Basis of the Obese Mutation in ob2J Mice. Genomics. 42, 152-156.