Phenotypic Mutation 'Park2' (pdf version)
AllelePark2
Mutation Type nonsense
Chromosome11
Coordinate59,565,128 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Nlrp3
Gene Name NLR family, pyrin domain containing 3
Synonym(s) Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
Chromosomal Location 59,541,568-59,566,955 bp (+)
MGI Phenotype Strain: 3686871
Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning.
Accession Number

Ncbi RefSeq: NM_145827.3; MGI: 2653833

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000078440]
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: R917*

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably null
Phenotypic Category immune system, NALP3 inflammasome signaling defect
Penetrance  
Alleles Listed at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 1.00
IGL00573:Nlrp3 APN 11 59565116 missense probably benign 0.20
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.06
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 1.00
IGL02010:Nlrp3 APN 11 59549535 missense probably benign 0.00
IGL02116:Nlrp3 APN 11 59549184 missense probably damaging 1.00
IGL02334:Nlrp3 APN 11 59565083 missense probably benign 0.00
IGL02417:Nlrp3 APN 11 59566023 splice site 0.00
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 1.00
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.65
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Nd1 UTSW 11 59565974 missense probably benign 0.33
Nd14 UTSW 11 59555875 missense
Nd3 UTSW 11 59565974 missense probably benign 0.33
Nd5 UTSW 11 59565879 missense probably benign 0.00
Nd6 UTSW 11 59549354 missense possibly damaging 0.59
Nd7 UTSW 11 59555875 missense probably damaging 0.99
Nd9 UTSW 11 59549354 missense possibly damaging 0.59
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice donor site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.01
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission 036813-MU
Last Updated 03/02/2017 12:17 PM by Katherine Timer
Record Created 12/17/2012 10:50 PM by Hexin Shi
Record Posted 03/04/2013
Phenotypic Description
Figure 1. The Park2 mice exhibit attenuated inflammatory responses related to decrease secretion of IL-1β. IL-1β were determined by ELISA.  T1560, T1720, and T1559 (red dots) are Park2 mice.
Figure 2. Both homozygous and heterozygous Park2 mice exhibit attenuated IL-1β secretion in response to nigericin treatment.

The Park2 phenotype was initially identified among G3 mice for mutations induced by N-ethyl-N-nitrosourea (ENU) and tested in the NALP3 Inflammasome Screen. An IL-1β-specific ELISA determined that perintoneal macrophages isolated from Park2 mice have attenuated inflammatory responses related to decrease secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1); heterozgous Park2 animals also show a defect in IL-1β secretion following nigericin treatment (Figure 2). Park2 animals produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone (not shown), suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired.

Nature of Mutation

Whole genome sequencing using the SOLiD technique identified 31 mutations in the G1 mouse.  One of which was a mutation in Nlrp3. Mutations in Nlrp3 have been documented to cause defects in the NALP3 Inflammasome Screen (click on Figure 3 in "Protein Prediction" for our ENU-induced Nlrp3 mutations).  Capillary sequencing of Nlrp3 (n = 10 G3 mice) identified a C to T transition at base pair 59378630 (v37) on chromosome 11 in the GenBank genomic region NC_000077 encoding Nlrp3. The mutation corresponds to residue 2749 in the Nlrp3 cDNA (ENSMUST00000079476) in exon 9 of 11.

 

2737 CACCTCTATCTACGAAGCAATGCCCTT

913  -H--L--Y--L--R--S--N--A--L-

 

The mutated nucleotide is indicated in red lettering and results in substitution of arginine (R) 917 for a premature stop codon.

Protein Prediction

 

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The amino acid altered by the ND1 mutation is shown. Click on the image to view other mutations found in NLRP3. Click on each mututation for more specific information.

The Park2 mutation encodes a premature stop codon within the LRR domain of NLRP3 (Figure 3). The LRR domain assists in protein-protein interactions and in NLRP3 this domain binds to the nucleotide-binding domain (NBD) to prevent oligomerization and protein activation (1). The NBD consists of the NACHT and NAD domains together.

 

For more information about Nlrp3, please see the record for ND1.

Putative Mechanism

The Park2 mutation results in coding of a premature stop codon at residue 917. It is possible that this mutation results in the loss of protein oligomerization and activation.  The Park2 mutation is in proximity to the ND1 and ND5 mutations in Nlrp3, both of which are proposed to be inactivating mutations. The phenotype of the Park2 mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.  In addition, the loss of IL-1β secretion in the heterozygous mouse indicates that this mutation alters the function of the wild-type protein.

Primers PCR Primer
Park2(F):5'- AAGTTGGAAGGATGCAGCTCGC -3'
Park2(R):5'- AATGAATGTTTGCAGTTGGCAGGAC -3'

Sequencing Primer
Park2_seq(F):5'- GCAGTGACACACAATGTCTG -3'
Park2_seq(R):5'- GGCTTAGCCTTTAAGCTGTATACC -3'
Genotyping

Park2 genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification and sequencing:

 

PCR Primers

Park2_For: 5’- AAGTTGGAAGGATGCAGCTCGC -3’

Park2_Rev: 5’ -AATGAATGTTTGCAGTTGGCAGGAC -3’

 

Sequencing Primer

Park2_Seq_For: 5’ - GCAGTGACACACAATGTCTG -3’

 

PCR program

1) 94° C        2:00

2) 94° C        0:30

3) 57° C        0:30

4) 72° C        1:00

5) repeat steps (2-4) 29x

6) 72° C        7:00

7) 4° C            -

 

The following sequence of 449 nucleotides (from Genbank genomic region NC_000077.6 of the linear genomic sequence Mus musculus strain C57BL/6J chromosome 11, GRCm38.p1 C57BL/6J encoding Nlrp3) is amplified:

 

  1 aagttggaag gatgcagctc gcagtgacac acaatgtctg agagagcctg ggcactgagg

 61 actccttctc ttcttcctat aggttggtga attccggcct tacttcaatc tgttgttcag

121 ctctgacctc tgtgctcaaa accaaccaga acttcacaca cctctatcta cgaagcaatg

181 cccttggaga cacaggactc aggctcctct gtgaggggct tctgcacccg gactgtaaac

241 tacagatgct ggagtgagtt catgggctgc ctgaggtgat gggaacatgg ggtgtgaggc

301 aggccctgga gcaaccctga tgcaaatctg tgtctgagga gtgaggcgtt cttggtgtcc

361 attagtgaga aatgggaagt ttctagatgg tatacagctt aaaggctaag cccctgccac

421 cacagtcctg ccaactgcaa acattcatt

 

PCR primer binding sites are underlined; the sequencing primer binding site is highlighted; the mutated C is highlighted in red.

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsHexin Shi, Ying Wang, Bruce Beutler