Phenotypic Mutation 'voldemort' (pdf version)
List |< first << previous [record 547 of 584] next >> last >|
Allelevoldemort
Mutation Type
Chromosome15
Coordinate
Base Change
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Chromosomal Location 11,000,721-11,029,233 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_053077; MGI:2153040

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000022851 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:MFS_1 36 364 2.1e-14 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Phenotypic Category Autosomal Recessive
Penetrance  
Alleles Listed at MGI

All alleles(20) : Chemically induced (ENU)(10) Spontaneous(7) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 missense probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 nonsense
cheng UTSW 15 11025868 missense probably damaging 0.99
draco2 UTSW 15 11000817 missense probably benign 0.05
galak UTSW 15 11012667 nonsense
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.01
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created 2012-12-18 8:32 AM by Tiana Purrington
Record Posted 2014-09-16
Phenotypic Description
Figure 1. Phenotype of an adult voldemort mouse.

The voldemort mutation was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R0122, some of which exhibited a white coat color and black eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. Three G3 mice with the voldemort phenotype were genotyped at all 50 mutation sites and one mutation on chromosome 15, in Adamts12, was homozygous in all three mice. Subsequent analysis of three additional mice and 12 unaffected mice (all wild-type or heterozygous for the Adamts12 mutation) supported a causal relationship between the mutation in Adamts12 and the voldemort phenotype (LOD = 8.504). To confirm the causal relationship a TALEN knockout of Adamts12 (TALEN-Adamts12) was generated. All of the offspring from 12 TALEN-Adamts12 founders failed to recapitulate the voldemort phenotype, indicating that the mutation causing the voldemort phenotype was not identified. The Adamts12 mutation is closely linked to Slc45a2 and the voldemort phenotype is similar to that caused by Slc45a2 mutations [see the records for cardigan and zuckerkuss as well as Slc45a2uw-6J (MGI:5448550) and Slc45a2uw-7J (MGI:5448551)]. To confirm causality of the voldemort mutation by a complementation test for allelism, voldemort mice were mated to zuckerkuss mice that harbor a mutation in Slc45a2. The resulting offspring of the voldemort x zuckerkuss mating were white, indicating that the voldemort mutation is in Slc45a2.

Protein Prediction
Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. This image is interactive. Click on the image to view other mutations found in SLC45A2. Click on the mutations for more specific information.  

Slc45a2 encodes solute carrier family 45, member 2 (SLC45A2), a highly conserved protein with 12 membrane-spanning domains that functions as a melanocyte differentiation antigen and transporter protein that is necessary for normal pigmentation (Figure 2) (1;2). The location of the voldemort mutation in SLC45A2 is unknown.

 

Please see the record cardigan for information about Slc45a2.

Putative Mechanism

Homozygous mice with Slc45a2 mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and fur (3). In addition, mutations in SLC45A2 can cause oculocutaneous albinism, type IV (OCA4; OMIM: #606574). The voldemort mice exhibit similar hypopigmentation to the proposed null mutant cardigan, indicating that the SLC45A2voldemort is not functional.

Primers Primers cannot be located by automatic search.
Genotyping

Voldemort genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

PCR Primers

Voldemort_PCR_F: 5’-TGTTTCACCCAGACACATGAGAACATC-3’

Voldemort_PCR_R: 5’-GGGATCATGTTGCCTGGCAAGAATAC-3’

 

Component

Amount (μl)

template (tail DNA)

2

primer (1) (10 μM)

2

primer (2) (10 μM)

2

JumpStart ReadyMix

25

dd Water

19

total

50

 

PCR program
1) 95°C 3:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 2:00
5) repeat steps (2-4) 40X
6) 72°C 7:00
7) 4°C ∞

 

Primers for sequencing

Voldemort_F1: 5’- GACACATGAGAACATCTCACTTG -3’

Voldemort_R1: 5’- CCTGGCAAGAATACTTTTTGATGAGG -3’

 

The following sequence of 454 nucleotides is amplified (Chr. 15: 11215384-11215837, GRCm38; NC_000081):

 

tgtttcaccc agacacatga gaacatctca cttgttatta agtataaatt aaacacatag
ctttggattt ttacaaatat aagttaaggg ttttatatac caaataatta ggtttataca
attggctttc tcactgtgtc ttctgtttaa tgttcagaca gtcttgataa ctctgtgaaa
caagagctac agcgggagaa gtgggagagg aaaaccttgc ggagcagaag cctctcccga
cgttccataa gcaaggagag atgggtggag accctcgtgg tggccgacac gaagacggta
gagtaccatg gaagcgagaa cgtggagtcg tacatcctca ccatcatgaa tatggtatga
cagactgcat gaggggacag cagtgaccga agggataccc ttaaaatgtt cttcctcctc
atcaaaaagt attcttgcca ggcaacatga tccc

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is indicated in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsTiana Purrington
List |< first << previous [record 547 of 584] next >> last >|