Phenotypic Mutation 'blue' (pdf version)
List |< first << previous [record 37 of 511] next >> last >|
Alleleblue
Mutation Type missense
Chromosome3
Coordinate20,030,796 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Hps3
Gene Name Hermansky-Pudlak syndrome 3 homolog (human)
Synonym(s) coa, cocoa
Chromosomal Location 19,995,945-20,035,315 bp (-)
MGI Phenotype Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect.
Accession Number

NCBI RefSeq: NM_080634, NM_001146323, NM_001146324; MGI: 2153839

Mapped Yes 
Amino Acid Change Leucine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: L76R

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000012580)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All alleles(12) : Targeted(4) Gene trapped(1) Spontaneous(6) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20019807 missense possibly damaging 0.62
IGL00846:Hps3 APN 3 20025792 missense possibly damaging 0.91
IGL01320:Hps3 APN 3 20030469 missense probably benign 0.35
IGL01364:Hps3 APN 3 20003305 missense probably benign 0.00
IGL01751:Hps3 APN 3 20010966 missense possibly damaging 0.51
IGL01843:Hps3 APN 3 20029001 missense probably benign 0.20
IGL02294:Hps3 APN 3 20014048 missense probably benign 0.35
IGL02581:Hps3 APN 3 20003221 splice site 0.00
earl_grey UTSW 3 20017173 nonsense
gandalf UTSW 3 20012796 nonsense probably null
pam_gray UTSW 3 20017173 nonsense
R0107:Hps3 UTSW 3 20030796 missense probably damaging 1.00
R0245:Hps3 UTSW 3 20012796 nonsense probably null
R0421:Hps3 UTSW 3 20029316 missense probably benign 0.00
R0524:Hps3 UTSW 3 20012776 missense probably damaging 1.00
R0763:Hps3 UTSW 3 20003279 missense probably damaging 1.00
R1486:Hps3 UTSW 3 20019972 splice acceptor site probably benign
R1555:Hps3 UTSW 3 20019788 splice donor site probably benign
R1795:Hps3 UTSW 3 20012695 critical splice donor site probably null
R1864:Hps3 UTSW 3 20019959 critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20030527 missense probably benign 0.01
R2101:Hps3 UTSW 3 20012783 missense possibly damaging 0.90
R2221:Hps3 UTSW 3 20002363 missense probably benign 0.00
R2268:Hps3 UTSW 3 20012935 splice acceptor site probably benign
R2520:Hps3 UTSW 3 20029030 missense probably damaging 1.00
R3809:Hps3 UTSW 3 20018812 missense probably damaging 1.00
R3888:Hps3 UTSW 3 20003223 critical splice donor site probably null
R3942:Hps3 UTSW 3 19996939 missense probably damaging 1.00
R4022:Hps3 UTSW 3 20035261 missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20029229 missense probably damaging 1.00
R4739:Hps3 UTSW 3 20030410 missense probably null
R4823:Hps3 UTSW 3 20012726 missense probably benign 0.03
R4912:Hps3 UTSW 3 20014173 missense probably damaging 1.00
R5307:Hps3 UTSW 3 20012701 missense possibly damaging 0.89
R5569:Hps3 UTSW 3 20015596 missense noncoding transcript
R5859:Hps3 UTSW 3 20008870 nonsense probably null
X0021:Hps3 UTSW 3 20030749 missense probably benign 0.14
X0066:Hps3 UTSW 3 20015988 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock Live Mice
MMRRC Submission
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 12/27/2012 12:31 PM by Adam Dismang
Record Posted 03/28/2014
Phenotypic Description
Figure 1. The blue mice have gray fur (top). An unaffected C57BL/6J mouse is shown for reference (bottom).

Blue was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant (Figure 1). The blue homozygous mice have a gray coat. 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. Three G3 mice with the blue phenotype were genotyped at all 72 mutation sites and three mutations on chromosome 3 (in Hps3, Gm5538, and Zfhx4) were homozygous in two of the three blue mice and heterozygous in one of the three blue mice. Blue phenocopies the pam gray phenotype attributed to Hps3. Therefore, the blue phenotype was ascribed to the Hps3 mutation. The mutation in Hps3 is a T to G transversion at base pair 20030796 (v38) on chromosome 3, or base pair 4515 in the GenBank genomic region NC_000069. The mutation corresponds to residue 272 in the mRNA sequence NM_080634 within exon 2 of 17 total exons.

 

256 GAAGCCGGAGACTATCTGGTAGCAATTGAGGAG

71  -E--A--G--D--Y--L--V--A--I--E--E-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to arginine (R) substitution at residue 76 in the HPS3 protein.

Protein Prediction
Figure 2. A, Predicted domains of HPS3. HPS3 contains a putative clathrin-binding (CB) motif, two consensus dileucine-based sorting motifs and an endoplasmic reticulum (ER) membrane retention signal. Amino acid locations are based on the human protein. The location of the blue mutation is indicated in red. Image is interactive: click to see other mutations in Hps3 (red indicates phenotypic mutations; green are incidental mutations). B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?).

The blue mutation (L76R) is not within or near known functional domains of HPS3 (Figure 2).

 

Please see the record pam gray for information about Hps3.

Putative Mechanism

Mutations in Hps3 have been documented to result in pigmentation defects [(1); MGI:2153839; pam gray; gandalf]. Mutations in Hps3 may alter protein trafficking during the maturation of melanosomes, resulting in hypopigmentation (2;3).  Proteins affected may include LAMP1 and LAMP3, and components of the melanin biosynthesis pathway, tyrosinase (mutated in ghost, pale rider, siamese), Tyrp1 (mutated in chi), and Tyrp2.

Primers PCR Primer
blue(F):5'- AGTCAAATGCATCACGTACCTTCCG -3'
blue(R):5'- CACACCTCAGAGGCTGTTGCTTAG -3'

Sequencing Primer
blue_seq(F):5'- CCATGTATAGGGTCTGACTCCAG -3'
blue_seq(R):5'- AGAGGCTGTTGCTTAGATGTCAG -3'
Genotyping
DNA trace file of the blue mutation. Chr. + strand.

Blue genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Blue(F): 5’- AGTCAAATGCATCACGTACCTTCCG -3’

Blue(R): 5’- CACACCTCAGAGGCTGTTGCTTAG-3’

 

Sequencing Primer

Blue_seq(F): 5’- CCATGTATAGGGTCTGACTCCAG -3’


 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 664 nucleotides is amplified (Chr.3: 20030295-20030958, GRCm38; NC_000069):

 

agtcaaatgc atcacgtacc ttccgcctct ttcaatggat tgctggtttc ttgtgggtgg

tggtcaacac tctctccatg tatagggtct gactccagtt ttaggagtaa gacttctaaa

tcagacatga cagcaacata tccaacacaa aaagagattt caacaggagt gatattatct

atgtgtataa ttaatgaacg ttcaaagttc aatattgaga attcctcatt aatgatatca

tacttcaaag taaataacac taacttattt gtacatccaa caagaagatc tcctttcaca

ggacaacacg aaaagcacaa aggggcctca gacattggca tctcaattat agacatctgg

tctctaaagc tttcacagaa ggatgcctcc acattgtggc caaccattcg aatgcacaca

cgggagttgt cgctcctctt actcctccaa ttcacgtaag cacgcaggaa tatagttttg

tttttctcct caattgctac cagatagtct cctaaaaaag gaagcaagat tgcatttgga

tcttagaatt acaaactcaa cgacttattt tgctgcctga aaatggaatg tataatataa

cacaggaatc actaactcaa agaaggaaca cagctgacat ctaagcaaca gcctctgagg

tgtg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (A>C, Chr. + strand; T>G, sense strand).

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
List |< first << previous [record 37 of 511] next >> last >|