Phenotypic Mutation 'Cuties'

• Allele: Cuties
• Mutation Type: nonsense
• Chromosome: 1
• Coordinate: 138,471,980 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Nek7
• Gene Name: NIMA (never in mitosis gene a)-related expressed kinase 7
• Synonym(s): 2810460C19Rik
• Chromosomal Location: 138,411,575-138,547,481 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NIMA-related kinases share high amino acid sequence identity with the gene product of the Aspergillus nidulans 'never in mitosis A' gene, which controls initiation of mitosis.[supplied by OMIM, Jul 2002] ; PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit infertility, decreased susceptibility to EAE, decreased body weight, abnormal gait, slight parasis and abnormal immune system response. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000027642] [ENSMUSP00000140903] [ENSMUSP00000140635]
• AlphaFold: Q9ES74
• SMART Domains: Protein: ENSMUSP00000027642; Gene: ENSMUSG00000026393; AA Change: C53*

Domain	Start	End	E-Value	Type
S_TKc	34	299	1.86e-91	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000140903; Gene: ENSMUSG00000026393; AA Change: C53*

Domain	Start	End	E-Value	Type
S_TKc	34	299	1.86e-91	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000140635; Gene: ENSMUSG00000026393; AA Change: C53*

Domain	Start	End	E-Value	Type
S_TKc	34	299	1.86e-91	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice, Sperm
• MMRRC Submission: 038223-MU
• Last Updated: 2019-01-23 9:36 AM by External Program
• Record Created: 2013-02-03 8:34 PM by Hexin Shi
• Record Posted: 2015-12-08
• Science Writers: Anne Murray
• Illustrators: Peter Jurek, Katherine Timer
• Authors: Hexin Shi, Ying Wang, Bruce Beutler

Accession Number

NCBI Refseq: NM_021605.3; MGI:1890645

Alleles Listed at MGI

All alleles(30) : Targeted(3) Gene trapped(27)

Phenotypic Description

Figure 1. Cuties mice exhibited decreased IL-1β secretion from macrophages in response to nigericin. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Impaired NLRP3 inflammasome activation in macrophages from Cuties mice. ( d , e ) ELISA of ( d ) IL-1β and ( e ) IL-18 in supernatants of Nek7 +/+ , Nek7 +/Cu , Nek7 Cu/Cu and Nlrp3 −/− peritoneal macrophages primed with LPS without further stimulation (None) or primed with LPS and treated with various inflammasome stimuli (horizontal axes). ( f ) Pyroptosis of peritoneal macrophages treated as in d , e , assessed as release of lactate dehydrogenase (LDH) into the culture medium, presented relative to total lactate dehydrogenase activity in lysates of unstimulated cells. * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001 and **** P ≤ 0.0001 (unpaired, two-tailed Student's t -test). Data are representative of one experiment ( a , b ), two experiments ( c ) or two independent experiments ( d – f ; mean and s.d. of n = 5 mice ( Nek7 +/+ and Nek7 +/Cu ) or 4 mice ( Nek7 Cu/Cu and Nlrp3 −/− ) per genotype). Figure obtained from ( 1 ).

Figure 3. Specific, functional defect in NLRP3 inflammasome activation in Cuties mice. ELISA analysis of IL-1β secretion by ( a ) BMDM and ( b ) BMDC primed with LPS and treated with the indicated stimuli ( n = 3 mice per genotype). Figure obtained from ( 1 ).

Figure 4. NEK7 promotes an inflammatory response in vivo . ( a , b ) Quantification of peritoneal exudate cells (PECs), neutrophils (Ly6G + F4/80 − ) and monocytes-macrophages (F4/80 + ) in the peritoneum of Nek7 +/+ , Nek7 +/Cu and Nek7 Cu/Cu mice ( a ) or chimeras generated by reconstitution of irradiated Nek7 +/+ host mice with Nek7 +/+ or Nek7 −/− donor bone marrow (key) ( b ), assessed by flow cytometry 6 h after intraperitoneal injection of MSU. Each symbol represents an individual mouse; small horizontal lines indicate the mean. ( c ) ELISA of IL-1β in the peritoneal lavage fluid of Nek7 +/+ mice at 6 h after injection of PBS (germline; n = 4) or of chimeras as in b at 6 h after injection of MSU ( n = 4 host mice per donor genotype). ( d ) Clinical score of wild-type (WT), Nek7 −/− and Nlrp3 −/− mice 0–21 d after immunization with recombinant human myelin oligodendrocyte glycoprotein (for induction of EAE) on day 0. ( e ) Quantification of various cell types of the immune system (horizontal axes) in the spinal cords of mice 21 d after immunization as in d ( n = 4 per genotype), assessed by flow cytometry. Subsets were gated as natural killer (NK) cells (NK1.1 + CD3ε − ), monocytes-microglia (CD11b + Gr1 − ), neutrophils (CD11b + Gr1 + ) or lymphocytes (CD45 hi CD11b − ). * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001 and **** P ≤ 0.0001, relative to wild-type in d (unpaired, two-tailed Student's t -test). Data are representative of two independent experiments ( a – c ; mean and s.d. in c ) or one experiment ( d , e ; mean ± s.e.m. in d ; mean and s.d. in e ). Figure obtained from ( 1 ).

Figure 5. ROS, Ca2+ influx, and cAMP in Cuties macrophages in response to NLRP3 inflammasome stimuli. a ) Mitochondrial ROS in wild-type peritoneal macrophages primed with LPS (Mock) or in Nek7 +/+ , Nek7 +/Cu and Nek7 Cu/Cu macrophages primed with LPS and treated with nigericin, assessed by flow cytometry of cells stained with a fluorogenic dye targeted to mitochondria (MitoSOX). ( b ) Calcium influx in Nek7 +/+ and Nek7 Cu/Cu peritoneal macrophages stained with the calcium indicator Fluo-4-AM, then imaged as untreated cells (time 0) and at 15-second intervals (for 30 min) after the addition of ATP (above plot) to the culture medium; fluorescence intensity of all cells in a field (representative of four independent fields) is presented relative to that at time 0. ( c ) Intracellular cAMP in Nek7 +/+ and Nek7 Cu/Cu peritoneal macrophages left untreated (UT) or primed with LPS and left untreated (LPS) or treated with nigericin (LPS + nigericin) or ATP (LPS + ATP). * P ≤ 0.01 (unpaired, two-tailed Student's t -test). Data are representative of two independent experiments ( n = 3 mice per genotype; mean and s.d. in b , c ). Figure obtained from ( 1 ).

Figure 6 . NEK7 is necessary for NLRP3-ASC complex formation and ASC oligomerization. ( a ) Immunoblot analysis of NLRP3, pro-caspase-1, pro-IL-1β, ASC and NEK7 in cell lysates (Lys) and of mature IL-1β (p17) and active caspase-1 (p10 subunit) in culture supernatants (Sup) of Nek7 +/+ (+/+), Nek7 +/Cu (+/Cu), Nek7 Cu/Cu (Cu/Cu) and Nlrp3 −/− peritoneal macrophages left untreated or primed with LPS and left unstimulated or stimulated with nigericin or ATP. ( b ) Immunoprecipitation (IP) and immunoblot analysis of the NLRP3-ASC association in peritoneal macrophages as in a (top); Input (below), immunoblot analysis of the samples above without immunoprecipitation (throughout). ( c ) Immunoblot analysis of lysates of peritoneal macrophages as in a solubilized with Triton X-100–containing buffer, followed by cross-linkage of insoluble fractions with disuccinimidyl suberate to capture ASC oligomers and analysis of those fractions (I + DSS) and soluble fractions (S) with antibody to ASC. Data are representative of two independent experiments. Figure obtained from ( 1 ).

The Cuties phenotype was identified among N-ethyl-N-nitrosourea (ENU) G3 mice of the pedigree R0103, some of which showed reduced IL-1β secretion from LPS-primed macrophages after stimulation with nigericin (Figure 1) (1). In addition, some mice exhibited reduced IL-1β secretion from LPS-primed macrophages stimulated with ATP and alum [Figure 2D] (1). Some mice also exhibited impaired NLRP3-dependent IL-18 production (Figure 2E) and pyroptosis (Figure 2F) of LPS-primed macrophages simulated with nigericin, ATP, or alum (1). IL-1β and IL-18 secretion from macrophages upon E. coli or C. rodentium infection was also reduced (Figure 2D,E) (1). IL-1β and IL-18 secretion were comparable to those of wild-type macrophages upon stimulation with flagellin or poly(dA:dT), which are inducers of the NLRC4 and AIM2 inflammasome, respectively (1). IL-1β secretion from bone marrow-derived macrophages (Figure 3A) and bone marrow-derived dendritic cells (Figure 3B) stimulated with nigericin, ATP, or alum was also reduced (1).

When challenged with monosodium urate crystals (MSU), some Cuties mice exhibited reduced NLRP3-dependent recruitment of total cells, neutrophils, and F4/80 positive monocytes/macrophages to the peritoneal cavity (Figure 4A) (1). Bone marrow chimeras generated by reconstitution of irradiated wild-type mice with either wild-type or Cuties bone marrow exhibited similar responses to non-chimeric wild-type and Cuties mice, respectively (Figure 4B). IL-1β secretion in the lavage fluid was reduced in Nek7^-/- bone marrow chimeras compared to wild-type chimeras (Figure 4C) (1). When exposed to IL-1β-driven experimental autoimmune encephalitis, some Cuties mice exhibited reduced disease severity compared to wild-type mice (Figure 4D) as well as reduced recruitment of lymphocytes (CD4, CD8, TCRγδ, and CD19⁺ B cells), monocytes/microglia, and NK cells to the spinal cord (Figure 4E) (1).

Cuties macrophages induced similar levels of mitochondrial reactive oxygen species after nigericin treatment (Figure 5A) (1). In addition, ATP-induced calcium influx into the cytoplasm was similar between wild-type and Cuties macrophages, although intracellular calcium levels decreased more rapidly in Cuties macrophages than in wild-type macrophages after ATP exposure (Figure 5B) (1). Cyclic AMP levels were increased in Cuties macrophages compared to wild-type macrophages after LPS-priming and nigericin stimulation (Figure 5C) (1).

After priming with LPS followed by nigericin stimulation, Cuties macrophages exhibited less association of NLRP3 with ASC than that in wild-type macrophages (Figure 6B). In addition, the macrophages exhibited a failure of ASC oligomerization (Figure 6C). The amount of mature IL-1β and active caspase-1 secretion from Cuties macrophages was reduced after nigericin treatment compared to that in wild-type mice (Figure 6A).

Some mice weighed an average of 30% less than their wild-type littermates (data not shown). In addition, some mice exhibited an abnormal gait and slight paresis of the limbs as well as infertility (data not shown).

Nature of Mutation

Figure 7. DNA trace file.

Figure 8. Linkage mapping of reduced IL-1β secretion after nigericin stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 93 mutations (X-axis) identified in the G1 male of pedigree R0103. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 95 mutations. The reduced NLRP3 inflammasome response was linked to a mutation in Nek7: a T to A transversion at base pair 138,544,242 (v38) on chromosome 1, or base pair 75,538 in the GenBank genomic region NC_000067 (Figure 7). Linkage was found with an additive model of inheritance, wherein eight variant homozygotes and 27 heterozygous mice departed phenotypically from 17 homozygous reference mice with a P value of 1.153 x 10^-5 (Figure 8).

The mutation corresponds to residue 332 in the Nek7 transcript in exon 3 of 10 total exons.

142 GTTTATAGAGCATCCTGTCTCTTGGATGGAGTG 48  -V--Y--R--A--S--C--L--L--D--G--V-

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine (C) 53 for a premature stop codon in the NEK7 protein.

Protein Prediction

Figure 9. Domain structure of Nek7 . The protein kinase domain (PKD) of Nek7 is at the C-terminus followed by an 8 amino acid C-terminal tail. The N-terminal extension (NTE) of the PKD is at amino acids 20-33 and serves as a structural component of the catalytic domain, regulating its activity. The Cuties mutation is at residue 53 and results in coding of a premature stop codon. Amino acids 20-66 would not be coded if a novel splicing event occurs that results in excision of exon 3.

Figure 10. Crystal structure of NEK7. The apo-form of human NEK7 is shown. The figure on the right highlights the residues that could be lost upon excision of exon 3 upon a errant splicing event. Figure is based on PDB: 2WQM and ( 11 ).

NEK7 is a member of the NEK family of serine/threonine kinases. The NEK kinases are related to the Aspergillus nidulans kinase NIMA, a kinase that functions in several aspects of mitosis including chromatin condensation, spindle organization, and nuclear envelope breakdown (2-7). The C-terminal catalytic domains of NIMA and the mammalian NEK proteins differ in length, sequence, and organization, but they share 40-50% amino acid sequence identity (6;8). The highly conserved NEK6 and NEK7 kinase domains share ~87% amino acid identity and 91% similarity; the residues that line the ATP-binding pocket are 100% identical (7;9-11). NEK6 and NEK7 only significantly differ from each other within the N-terminal extension (amino acids 20-33 in human NEK7); the extension is a structural component of the catalytic domain and regulates its activity [Figure 9; (11;12); reviewed in (13)]. The N-terminal extension of the catalytic domain forms an extended ordered loop wrapped around the side chain of Asn33 to form three hydrogen bonds: the backbone oxygen of Gly27 and the backbone oxygen of Arg23 with the Asn33 side-chain nitrogen; the backbone nitrogen of Arg23 forms a hydrogen bond with the Asn33 side-chain oxygen (11). Mutation of Asn33 leads to destabilization of the structure around residue 33 (11). The N-terminal extension sits on the core catalytic domain between the β4 and the β2-β3 loop (11).

Several NEK7 residues are essential for NEK7 function. For example, mutation of lysine (Lys) 65 (Lys65Met) within the ATP-binding pocket causes aberrant NEK7 kinase activity (10). Furthermore, a Lys63Met/Lys64Met mutant exhibited complete loss of function (10). Lys75 is proposed to be an ATP-interacting residue, and mutation of Lys75 (Lys75Met) resulted in a complete loss of enzyme activity (12). The catalytic domains of the NEK proteins contain a His-Arg-Asp motif, which is often found in kinases that are positively regulated through phosphorylation (14). The NEK proteins also contain either serine or threonine residues within the activation loop that may be phosphorylated (either by autophosphorylation or by an upstream kinase that activates (or regulates the localization of) the kinase; in NEK7, phosphorylation of Thr191, Ser195 (via NEK9/Nercc1 in mitosis), and Ser204 is proposed to regulate NEK7 activity [(5;6;12;15-18); reviewed in (13;19)]. A Ser195Ala NEK7 mutant was able to function in centriole duplication, indicating that NEK9-mediated activation of NEK7 is not essential for NEK7 function (20).

All of the NEK C-terminal domains contain a coiled-coil oligomerization motif that promotes autophosphorylation and activation of the protein (6). In contrast to other NEK kinases, NEK7 and NEK6 do not have C-terminal regulatory domains. The NEK7 catalytic domain is at the extreme C-terminus and is followed only by an eight amino acid tail [Figure 9; (9;21); reviewed in (13)]. In addition to its role in NEK7 phosphorylation and activation, the C-terminal region of inactive NEK9 can also function to inhibit NEK7 function during interphase [reviewed in (13)]. Interaction of the non-catalytic domain of NEK9 with NEK7 also serves to disrupt the auto-inhibitory conformation of NEK7 to facilitate its activation (11).

The crystal structure of full-length human NEK7 (PDB: 2WQM) revealed that the conformation of the αC helix, aspartic acid, leucine, glycine (DLG) motif (a motif at the N-terminus of the activation loop that activates a divalent cation associated with the γ-phosphate of ATP), and the activation loop were in a distinct, inactive conformation [Figure 10; (11)]. NEK7 is maintained in an inhibited conformation by an autoinhibitory motif in which the aromatic side-chain of Tyr97 (within the N-terminal lobe) points downwards into the active site and forms a hydrogen bond with the backbone amide of Leu180 within the DLG motif (11). Furthermore, the αC helix is positioned such that the salt bridge between Lys63 and Glu82 cannot form (11). The downward orientation of Tyr97 prevents an inward, active conformation of the αC helix (11). Mutation of Tyr97 to an alanine (Tyr97Ala) results in an approximate 5-fold increase in activity compared to the wild-type protein during interphase (6;11). The Tyr97Ala mutation results in breakage of the H-bond in the DLG motif and removes the hydrophobic block between αC (Leu86) and the gatekeeper residue (Leu111) (11).

The Cuties mutation results in substitution of cysteine (C) 53 for a premature stop codon. Cysteine 53 is within the kinase domain. NEK7 protein was not detected in homozygous Cuties macrophages, indicating nonsense-mediated decay of the Nek7^Cuties transcript (1).

Expression/Localization

At embryonic day (E) 6.75 in the mouse, Nek7 RNA is restricted to the site of the decidual reaction (i.e., the area where the blastocyst contacts the endometrial decidua) (7). As development of the embryo progresses (E8.75), Nek7 RNA is detected in the decidual cells surrounding the ectoplacental cone and immediately adjacent to the primary giant trophoblasts (7). When the decidua retracts by mid-gestation, the Nek7 signal is weaker; by late-gestation only a faint signal is detected (7). During early embryogenesis (E6.5-9.5), Nek7 is expressed in a low, homogeneous pattern in the embryo. By E11, Nek7 is expressed in the septum transversum (i.e., cranial mesenchyme that develops into the caudal part of the ventral mesentery of the foregut) (7). By E13.5, Nek7 is expressed in the developing dorsal thalamus; this signal increases later in development (7). Nek7 is highly expressed in the embryonic olfactory bulb and in the olfactory epithelium (7). In the adult, Nek7 is not expressed in glial-specific regions in the brain and appears to be restricted to neurons; Nek7 is also expressed in the adult ovary (i.e., granulosa cells of large growing and antral follicles), the kidney, heart, intestine, and placenta, and expressed at low levels in all other tissues (7-9).

NEK7 is a cytoplasmic protein that is expressed at constant levels throughout the cell cycle and is concentrated at the centrosome in interphase and mitotic cells [(22;23) reviewed in (13)]. In late mitosis, NEK7 concentrates at the spindle midzone and midbody (10;23). NEK7 does not associate with chromosomes following the metaphase-to-anaphase transition; also, NEK7 is not at the midbody during telophase or at the spindle midzone at cytokinesis (22). Although the levels of NEK7 remain constant throughout the cell cycle, its activity oscillates and reaches a maximum at the M phase (5;11;20). In vitro, NEK7 activity is activated by serum withdrawal; NEK7 can be re-stimulated with serum indicating a serum factor(s) represses NEK7 activity (12). In addition, treatment with the mitotic inhibitors nocodazole and taxol result in repressed NEK7 activity in HEK293 cells; treatment with the DNA synthesis inhibitors aphidicolin and hydroxyurea maintained the activity (12).

Background

Figure 11. Nek7 functions throughout the process of eukaryotic cell division. The three main stages in the cell cycle (interphase, mitosis, and cytokinesis) are shown. Cells remain in interphase approximately 90% of the time. During mitosis several steps mediate nuclear division. In prophase, the chromatin condenses into chromosomes and the nuclear envelope disappears. In metaphase, the chromosomes align at the equatorial plate. In anaphase, the sister chromatids separate and the centromeres divide. In telophase, the chromatin expands and the cytoplasm divides.The cell divides in cytokinesis. See the text for details on NEK7 throughout the cell cycle.

Eleven members of the NEK family of kinases have been identified to date (15). The NEK kinases have diverse functions including roles in ciliary development (NEK1 and NEK8) (19;24), regulation of the centrosome (NEK2, NEK7) (25), control of mitotic spindle formation (NEK9/Nercc1/NEK7) (16), regulation of mitosis (NEK6 and NEK7) (22;26) and NLRP3 inflammasome function (NEK7) (1).

β-casein, histones, and myelin basic protein are known substrates of NEK7 (12). NEK6 and NEK7 also interact and phosphorylate the kinesin motor protein, Eg5, a protein necessary for spindle bipolarity in mitosis (27;28). NEK6 and NEK7 phosphorylate the regulatory site (Thr412) of the p70 S6 kinase (S6K) in vitro; S6K functions in growth signal transduction pathways by phosphorylating the 40S ribosomal protein S6 following exposure to zinc, amino acids, and mitogens [(8;12;29-32); reviewed in (13)]. In vivo studies have had conflicting results on whether NEK7 is a physiological kinase of S6K [(5;33); reviewed in (19)]. In contrast, another study determined that NEK7 phosphorylates S6K Thr412 in vivo, but it is not the major kinase (12). The known functions of NEK7 are discussed in more detail, below.

Nek7 functions throughout cell division

The centrosome is a microtubule-organizing center that functions in cell morphology, motility, and intracellular transport [Figure 11; (20)]. The centrosome is composed of a pair of centrioles surrounded by pericentriolar material (PCM) (20). Prior to chromosome segregation into two daughter cells during mitosis, the centriole is duplicated (20). The two pairs of centrioles are surrounded by PCM (in G1 and S phase) and eventually form two mitotic spindle poles (20). Defects in centriole duplication can lead to bipolar spindle formation and aneuploidy (20). NEK7 is essential in the centrosome cycle for centriole duplication, PCM accumulation, and centrosome cycle progression during interphase (6;20). NEK7 depletion results in a loss in centriole duplication, with the NEK7 depleted cells having one or two centrioles as well as a loss in PCM accumulation and/or recruitment at the centrosome; overexpression of NEK7 at the centrosome resulted in the induction of the formation of extra centrioles (20). Kim et al. proposed that NEK7 functions in centriolar linkage (which should be maintained until G2-M phase) as well as the recruitment of PCM proteins necessary for centriole duplication in interphase and subsequent spindle assembly in M phase (20).

Small interfering RNA (siRNA)-mediated downregulation of Nek7 leads to mitotic defects including prometaphase arrest (with activation of the spindle assembly checkpoint), mitotic spindle defects, reduced spindle α-tubulin intensity, and multinuclear cells (10;20;22;23). In NEK7-depleted cells, centrosomal γ-tubulin levels were reduced, indicating that NEK7 functions to recruit γ-tubulin to the centrosome [(23); reviewed in (13)]. RNA interference (RNAi)-mediated loss of Nek7 expression also led to decreased centrosome-associated γ-tubulin and microtubule nucleation (10). Furthermore, NEK7 also regulates spindle formation through the phosphorylation of tubulin (10). The spindle defects and centriole duplication observed upon loss of Nek7 expression was proposed to be due to a reduction in γ-tubulin-mediated microtubule nucleation and/or attachment with the centrosomes or spindle poles in mitosis (6;10;23;34). NEK7 is proposed to function in the recruitment of γ-tubulin to the spindle poles (6). Defects in microtubule attachment would subsequently lead to metaphase arrest (10).

NEK7 is also required for microtubule nucleation in interphase cells (15;23). NEK7 accelerates growth and depolymerization velocities, expands the time spent in catastrophe, and increases microtubule dynamicity (15). Cohen et al. found that microtubule dynamic instability is dependent on NEK7 levels: siRNA-mediated reduction in Nek7 led to slower interphase microtubule growth (by 14%) and shrinkage speeds and slower microtubule dynamicity; NEK7 overexpression led to inverse phenotypes (15).

In addition to its role in centriole duplication, spindle assembly, and microtubule dynamics, NEK7 is also essential for the completion of cytokinesis (6;10;23;35). NEK7 is proposed to function in the localization of factors required for cytokinesis and/or microtubule-mediated stabilization of the central spindle (similar to its function in metaphase) (6;10).

Loss of Nek7 expression and/or function leads to mitotic arrest and apoptosis

Nek7-depleted cells, or cells that express kinase-defective NEK7 (Lys64Met), proceed beyond metaphase, but often fail to complete abscission (6;10;23). In addition, knockdown of both Nek7 and Mad2 allowed cells to circumvent the spindle checkpoint and reduced the metaphase arrest phenotype; cells failed to undergo cytokinesis [reviewed in (13)]. Knockdown of Nek7 expression or overexpression of NEK7^Lys64Met causes several mitotic defects (e.g., increase in mitotic index and spindle defects such as multipolar spindles), growth inhibition, metaphase arrest, and apoptosis; NEK7-mediated apoptosis is dependent upon entry into mitosis and the extent of apoptosis is inversely related to NEK7 activity (10;22;23). Cells with depleted (either by siRNA or RNAi) NEK7 levels often arrest at mitosis with normal chromatin condensation and alignment, but they do not complete chromosome segregation, resulting in a three-fold increase in multinucleated cells [(22); reviewed in (13)]. The cells typically arrest at the spindle checkpoint and undergo apoptosis or complete mitosis with concomitant nuclear abnormalities [(22); reviewed in (13)]. NEK7 mutants with little to no activity (i.e., NEK7^Lys64Met) block cells in metaphase, but NEK7 mutants with partial activity (i.e., NEK7^Ser195Ala) progress beyond metaphase and are delayed in late mitosis (10). Furthermore, the spindles in cells expressing the NEK7^Lys64Met mutant were more fragile, with less-distinct microtubules and less-focused spindle poles (10). Kinase-dead mutants may interfere with the activity of NEK9 on other substrates (including NEK6) by sequestering NEK9 in an inactive complex (10).

Nek7 knockout (Nek7^-/-; MGI: 4999797) mice have a β-galactosidase (β-gal)–NeoR cassette replacing most of exons 3 and 4 resulting in the deletion of amino acids 76-112 in the NEK7 protein (35). The deletion of exons 3 and 4 yielded a null mutation and a novel splicing event (from exon 2 to exon 5); the resulting protein was nonfunctional (35). Nek7^+/- animals appeared normal; however, Nek7^-/- animals died in late embryogenesis or at early postnatal stages (usually within two weeks to one month) due to late mitotic delay and defects in cytokinesis (35). Length of survival was dependent on strain background: mice on the 129/ICR background survived longer than animals crossed onto the C57BL/6 or BALB/c inbred background (35). On the BALB/c background, homozygous animals started to die at around E12.5; only about 1% of Nek7^-/-mice born (35). Nek7^-/- mice that survived embryogenesis were smaller than their littermates and were less than 50% of the weight of wild-type or Nek7^+/- littermates at P20 (35). Mouse embryonic fibroblasts derived from the Nek7^-/- mice exhibited mitotic defects (without prometaphase or metaphase arrest) and genomic instability leading to polyploidy (35). Binuclear and multinuclear cells were common and incidence increased with each cell passage (35). Mononuclear mutant cells had larger than average nuclei (35). Taken together, NEK7 is essential for mammalian growth and survival as well as cytokinesis and the frequency of primary cilium formation (35).

Nek7 as a cancer marker

Mutations in NEK7 have been detected in genome-wide screenings of human cancers (36;37). Furthermore, high levels of NEK7 have been associated with tumor differentiation and metastasis of gallbladder carcinoma; NEK7 is significantly increased in gallbladder carcinoma compared to normal tissues (38). NEK7 (along with FoxM1 and Plk1) may be a potential prognostic indicator in gallbladder carcinoma patients (38).

Putative Mechanism

Figure 12. NLRP3 inflammasome pathway. NLRP3 is present in the cytosol in an inactive conformation state due to its association with the SGT1/HSP90 chaperone complex. The NLRP3 inflammasome is activated by a wide variety of agents. Several activators have been shown to generate pore formation by a pannexin hemichannel that may allow extracellular molecules access to the cytoplasm and contact with NLRP3. Extracellular ATP mediates inflammasome activation through the P2X7 ATP-gated ion channel, triggering rapid K+ efflux from the cell (decreased potassium (K+) concentration may favor inflammasome assembly). Rupture of lysosomes containing certain particulates releases Cathepsin B into the cytoplasm, activating the inflammasome. NLRP3 activators may also trigger inflammasome assembly by generating reactive oxygen species (ROS), often produced under situations of cellular stress. The inactive state of caspase-1 contains a CARD-containing prodomain. Oligomerization of NLRP3 and the recruitment of caspase-1, ASC, and CARDINAL leads to the autoproteolytic maturation of caspase-1. Caspase-1 is capable of cleaving pro-1L-1β, pro-IL-18, and pro-IL-33. These mature cytokines mediate a variety of biological effects by activating key processes such as the nuclear factor κB and mitogen-activated protein kinase (MAPK) pathways.

Figure 13. NEK7 directly interacts with the LRR domain of NLRP3 to promote inflammasome assembly. (a) Immunoblot analysis of lysates of RAW264.7 cells transfected with non-targeting control siRNA (NC) or Nek7 -specific siRNA (si Nek7 ), then primed with LPS and left unstimulated (top) or stimulated with nigericin (below), then franctionated by gel-filtration chromatography (fractions sizes at top). (b–e) Immunoprecipitation and immunoblot analysis of the interaction between hemagglutinin (HA)-tagged NEK7 and Flag-tagged components of the NLRP3 inflammasome, NLRC4, or AIM2 in HEK293T cells transfected to overexpress HA-tagged NEK7 (HA-NEK7) alone (−) or together with vector encoding Flag-tagged pro-IL-1β, ASC, pro-caspase-1, NLRP3, NLRC4 or AIM2 (above lanes) (b), vector encoding Flag-tagged full-length NLRP3 or truncations of NLRP3 containing only residues 1–90 (pyrin domain) (PYD), 91–710 (nucleotide-binding domain) (NBD) or 711–1033 (LRR domain) (LRR) (above lanes) ( c ) or vector encoding Flag-tagged full-length NLRP3 or truncations of NLRP3 with deletion (del) of various residues in the LRR domain (above lanes) (d), or transfected with vector encoding Flag-tagged NLRP3 and HA-tagged full-length NEK7 or mutants lacking (del) various residues (above lanes) (e). (f) Immunoassay of the endogenous NEK7-NLRP3 association in wild-type peritoneal macrophages primed with LPS and left unstimulated (−) or stimulated (+) with nigericin or ATP (above lanes), assessed by immunoprecipitation with immunoglobulin G (IgG), as a control, or with anti-NEK7, followed by immunoblot analysis with anti-NLRP3 or anti-NEK7. (g) Immunoblot analysis of lysates of wild-type peritoneal macrophages primed with LPS and left unstimulated (top) or stimulated with nigericin (below), fractionated by gel-filtration chromatography (fractions presented as in a). ( h ) Immunoprecipitation and immunoblot analyses (as in b ) of lysates of HEK293T cells transfected to overexpress HA-tagged NEK7 alone (−) or together with vector expressing Flag-tagged human NLRP3 (Flag-hNLRP3), in the wild-type form (WT) or mutant NLRP3 with the substitution G755A or G755R (above lanes). ( i ) ELISA of IL-1β in supernatants of wild-type peritoneal macrophages ( Nlrp3 +/+ ) or mutant peritoneal macrophages homozygous for the mutation resulting in the D946G substitution ( Nlrp3 D946G/D946G ), primed with LPS and stimulated with nigericin. Each symbol represents an individual mouse; small horizontal lines indicate the mean (±s.d.). * P ≤ 0.05 (unpaired, two-tailed Student's t -test). (j) Immunoprecipitation and immunoblot analyses (as in b ) of lysates of HEK293T cells transfected to overexpress HA-tagged NEK7 alone (−) or together with vector expressing Flag-tagged wild-type NLRP3 (WT) or mutant NLRP3 with the D946G substitution (above lanes). Data are representative of two independent experiments. Figure obtained from ( 1 ).

Figure 14. Activation of the NLRP3 inflammasome is blocked during mitosis. (a) Immunoprecipitation and immunoblot analysis of the NEK7-NLRP3 association in LPS-primed J774A.1 mitotic (M) or interphase (I) cells, with (+) or without (−) overexpression of HA-NEK7 and treatment with nigericin (above lanes). (b) Flow cytometry analyzing activated caspase-1 in mitotic or interphase J774A.1 cells primed with LPS and left unstimulated or stimulated with nigericin, together with fluorescent FAM-FLICA–caspase-1 probe specific for activated caspase-1 (left), and the frequency of those cells among mitotic and interphase cells (right). Figure obtained from ( 1 ).

Figure 15. NEK7 binds to NLRP3 and promotes inflammasome assembly and caspase-1 activation. During interphase, NEK7 is necessary for formation of a complex containing NLRP3 and the adaptor ASC, oligomerization of ASC, and activation of caspase-1. During mitosis, all available NEK7 is involved with mitotic spindle formation, separation of centrosomes, and with abscission during cytokinesis. Thus, NLRP3 inflammasome activation is blocked in mitotic cells.

Inflammasomes are large caspase-1-activating multiprotein complexes that assemble upon the detection of pathogenic or other danger signals in the cytoplasm (Figure 12). Certain members of the NLR family, including IPAF (ICE protease-activating factor), NLRP1b, and NLRP3 (see the record for Nd1), oligomerize and assemble into inflammasomes. Caspase-1 is a cysteine protease that is present under resting conditions in an inactive precursor form with an N-terminal CARD-containing prodomain capable of mediating homotypic interactions. The CARD domain of procaspase-1 recruits the protease to the inflammasome where it undergoes autoproteolytic maturation into its active form. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes in by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK) pathways. The adaptor protein ASC plays an important role in inflammasome assembly by binding to the NLRP3 PYD through its own PYD, and then recruiting procaspase-1 to the complex through its CARD domain [reviewed by (39)]. 

In macrophages, NEK7 functions as a switch between mitosis and NLRP3 inflammasome activation (1). NEK7 is not required for the induction of core inflammasome components, but is necessary for the subsequent formation of the NLRP3-ASC complex and activation of caspase-1. NEK7 directly binds NLRP3 to form a complex upon inflammasome stimulation (Figure 13A). The NEK7-NLRP3 interaction was mediated by the LRR domain of NLRP3 (Figure 13B-E). The association between NEK7 and NLRP3 is enhanced by nigericin or ATP stimulation in LPS-primed macrophages (Figure 13F,G). Mutations (G755A or G755R) within the NLRP3 LRR domain resulted in an increased amount of binding to NEK7 than that observed with wild-type NLRP3 (Figure 13H). In addition, a D946E mutant led to reduced NEK7 binding than wild-type NLRP3 (Figure 13I,J). Taken together, inflammasome assembly is essential for the interaction of NEK7 and NLRP3. The amount of NLRP3 that interacts with NEK7 increased upon priming with LPS plus nigericin stimulation in interphase cells compared to that in mitotic cells (Figure 14A). Stimulated cells in interphase exhibited more caspase-1 activation than mitotic cells (Figure 14B).

Primers

PCR Primer
Cuties_pcr_F: CCCCAGCCCCTAGTAACTGTCAA
Cuties_pcr_R: ACCCCTATAGCGTAAGCTTCCCC

Genotyping

DNA trace file of Cuties +/- genotyping. The Cuties mutation is an A to T transversion on the Chr. + strand.

Cuties genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  The following primers are used for PCR amplification:

Primers for PCR amplification

Cuties(F):  5’-CCCCAGCCCCTAGTAACTGTCAA-3’

Cuties(R):  5’-ACCCCTATAGCGTAAGCTTCCCC-3’

Primer for sequencing

Cuties_seq(F):  5’-GATATGGAAAACTTAGTTTCCACCCC-3’

PCR program

1) 94°C        2:00

2) 94°C        0:30

3) 57°C        0:30

4) 72°C        1:00

5) repeat steps (2-4) 29x

6) 72°C        7:00

7) 4°C            ∞

The following sequence of 714 nucleotides is amplified (Chr. 1: 138,543,844-138,544,557, GRCm38; NC_000067):

ccccagcccc tagtaactgt caaaaccaaa aaaaataacc atagtctgag tctcatttat
ttgtaagcta gtcaggaata agcataaagt gattatactg tatattaatt tctatgtatt
agagccacat atatacaatg agaacaggac agatctatca taggccttgt gcaaacatga
tatggaaaac ttagtttcca ccccttatta ccttcaaaat aagcttttta aaatacagtg
ttctttctta ggattctcaa accatagttt catgacccaa atcattccag aaattgttcc
tatttaattt ttagacacca taacttcaca ttaattaatg cagttaaaaa tcatcttacc
tgtacttttt ttaacgctac cggcactcca tccaagagac aggatgctct ataaacttca
ctaaattgtc cacgaccaat tttcttttct attcggaagt tggctaaagt attatagccc
atatctggcc gtaatgcctt ctgcaatgaa aattaataca aaaaggtttt aatcatacaa
tattcacaaa gacatatgac ttaagtagat gaagatatgg tatacatggt atatactgcc
tacagtaaag ttgcaaacat cccacaccaa agatatttga gttccttgag aatgaatata
gaaggcaatt gaaaatacaa ctttaatcct gggggaagct tacgctatag gggt

Primer binding sites are underlined; sequencing primers are highlighted; the mutated nucleotide is highlighted in red (A>T in Chr. + strand (shown); T>A in sense strand).

References

  1. Shi, H., Wang, Y., Li, X., Zhan, X., Tang, M., Fina, M., Su, L., Pratt, D., Bu, C. H., Hildebrand, S., Lyon, S., Scott, L., Quan, J., Sun, Q., Russell, J., Arnett, S., Jurek, P., Chen, D., Kravchenko, V. V., Mathison, J. C., Moresco, E. M. Y., Monson, N. L., Ulevitch, R. J., and Beutler, B. (2015) NLRP3 Activation and Mitosis are Mutually Exclusive Events Coordinated by NEK7, a New Inflammasome Component. Nat Immunol. Dec 7.

  2. Oakley, B. R., and Morris, N. R. (1983) A Mutation in Aspergillus Nidulans that Blocks the Transition from Interphase to Prophase. J Cell Biol. 96, 1155-1158.

  3. Osmani, A. H., O'Donnell, K., Pu, R. T., and Osmani, S. A. (1991) Activation of the nimA Protein Kinase Plays a Unique Role during Mitosis that Cannot be Bypassed by Absence of the bimE Checkpoint. EMBO J. 10, 2669-2679.

  4. Osmani, S. A., Pu, R. T., and Morris, N. R. (1988) Mitotic Induction and Maintenance by Overexpression of a G2-Specific Gene that Encodes a Potential Protein Kinase. Cell. 53, 237-244.

  5. Belham, C., Roig, J., Caldwell, J. A., Aoyama, Y., Kemp, B. E., Comb, M., and Avruch, J. (2003) A Mitotic Cascade of NIMA Family Kinases. Nercc1/Nek9 Activates the Nek6 and Nek7 Kinases. J Biol Chem. 278, 34897-34909.

  6. Fry, A. M., O'Regan, L., Sabir, S. R., and Bayliss, R. (2012) Cell Cycle Regulation by the NEK Family of Protein Kinases. J Cell Sci. 125, 4423-4433.

  7. Feige, E., and Motro, B. (2002) The Related Murine Kinases, Nek6 and Nek7, Display Distinct Patterns of Expression. Mech Dev. 110, 219-223.

  8. Belham, C., Comb, M. J., and Avruch, J. (2001) Identification of the NIMA Family Kinases NEK6/7 as Regulators of the p70 Ribosomal S6 Kinase. Curr Biol. 11, 1155-1167.

  9. Kandli, M., Feige, E., Chen, A., Kilfin, G., and Motro, B. (2000) Isolation and Characterization of Two Evolutionarily Conserved Murine Kinases (Nek6 and nek7) Related to the Fungal Mitotic Regulator, NIMA. Genomics. 68, 187-196.

  10. O'Regan, L., and Fry, A. M. (2009) The Nek6 and Nek7 Protein Kinases are Required for Robust Mitotic Spindle Formation and Cytokinesis. Mol Cell Biol. 29, 3975-3990.

  11. Richards, M. W., O'Regan, L., Mas-Droux, C., Blot, J. M., Cheung, J., Hoelder, S., Fry, A. M., and Bayliss, R. (2009) An Autoinhibitory Tyrosine Motif in the Cell-Cycle-Regulated Nek7 Kinase is Released through Binding of Nek9. Mol Cell. 36, 560-570.

  12. Minoguchi, S., Minoguchi, M., and Yoshimura, A. (2003) Differential Control of the NIMA-Related Kinases, Nek6 and Nek7, by Serum Stimulation. Biochem Biophys Res Commun. 301, 899-906.

  13. O'regan, L., Blot, J., and Fry, A. M. (2007) Mitotic Regulation by NIMA-Related Kinases. Cell Div. 2, 25.

  14. Johnson, L. N., Noble, M. E., and Owen, D. J. (1996) Active and Inactive Protein Kinases: Structural Basis for Regulation. Cell. 85, 149-158.

  15. Cohen, S., Aizer, A., Shav-Tal, Y., Yanai, A., and Motro, B. (2013) Nek7 Kinase Accelerates Microtubule Dynamic Instability. Biochim Biophys Acta. .

  16. Roig, J., Mikhailov, A., Belham, C., and Avruch, J. (2002) Nercc1, a Mammalian NIMA-Family Kinase, Binds the Ran GTPase and Regulates Mitotic Progression. Genes Dev. 16, 1640-1658.

  17. Rellos, P., Ivins, F. J., Baxter, J. E., Pike, A., Nott, T. J., Parkinson, D. M., Das, S., Howell, S., Fedorov, O., Shen, Q. Y., Fry, A. M., Knapp, S., and Smerdon, S. J. (2007) Structure and Regulation of the Human Nek2 Centrosomal Kinase. J Biol Chem. 282, 6833-6842.

  18. Zalli, D., Bayliss, R., and Fry, A. M. (2012) The Nek8 Protein Kinase, Mutated in the Human Cystic Kidney Disease Nephronophthisis, is both Activated and Degraded during Ciliogenesis. Hum Mol Genet. 21, 1155-1171.

  19. Quarmby, L. M., and Mahjoub, M. R. (2005) Caught Nek-Ing: Cilia and Centrioles. J Cell Sci. 118, 5161-5169.

  20. Kim, S., Kim, S., and Rhee, K. (2011) NEK7 is Essential for Centriole Duplication and Centrosomal Accumulation of Pericentriolar Material Proteins in Interphase Cells. J Cell Sci. 124, 3760-3770.

  21. O'Connell, M. J., Krien, M. J., and Hunter, T. (2003) Never Say Never. the NIMA-Related Protein Kinases in Mitotic Control. Trends Cell Biol. 13, 221-228.

  22. Yissachar, N., Salem, H., Tennenbaum, T., and Motro, B. (2006) Nek7 Kinase is Enriched at the Centrosome, and is Required for Proper Spindle Assembly and Mitotic Progression. FEBS Lett. 580, 6489-6495.

  23. Kim, S., Lee, K., and Rhee, K. (2007) NEK7 is a Centrosomal Kinase Critical for Microtubule Nucleation. Biochem Biophys Res Commun. 360, 56-62.

  24. Mahjoub, M. R., Trapp, M. L., and Quarmby, L. M. (2005) NIMA-Related Kinases Defective in Murine Models of Polycystic Kidney Diseases Localize to Primary Cilia and Centrosomes. J Am Soc Nephrol. 16, 3485-3489.

  25. Fry, A. M. (2002) The Nek2 Protein Kinase: A Novel Regulator of Centrosome Structure. Oncogene. 21, 6184-6194.

  26. Yin, M. J., Shao, L., Voehringer, D., Smeal, T., and Jallal, B. (2003) The serine/threonine Kinase Nek6 is Required for Cell Cycle Progression through Mitosis. J Biol Chem. 278, 52454-52460.

  27. Blangy, A., Lane, H. A., d'Herin, P., Harper, M., Kress, M., and Nigg, E. A. (1995) Phosphorylation by p34cdc2 Regulates Spindle Association of Human Eg5, a Kinesin-Related Motor Essential for Bipolar Spindle Formation in Vivo. Cell. 83, 1159-1169.

  28. Rapley, J., Nicolas, M., Groen, A., Regue, L., Bertran, M. T., Caelles, C., Avruch, J., and Roig, J. (2008) The NIMA-Family Kinase Nek6 Phosphorylates the Kinesin Eg5 at a Novel Site Necessary for Mitotic Spindle Formation. J Cell Sci. 121, 3912-3921.

  29. Dufner, A., and Thomas, G. (1999) Ribosomal S6 Kinase Signaling and the Control of Translation. Exp Cell Res. 253, 100-109.

  30. Kim, S., Jung, Y., Kim, D., Koh, H., and Chung, J. (2000) Extracellular Zinc Activates p70 S6 Kinase through the Phosphatidylinositol 3-Kinase Signaling Pathway. J Biol Chem. 275, 25979-25984.

  31. Thomas, G. (2002) The S6 Kinase Signaling Pathway in the Control of Development and Growth. Biol Res. 35, 305-313.

  32. Hara, K., Yonezawa, K., Weng, Q. P., Kozlowski, M. T., Belham, C., and Avruch, J. (1998) Amino Acid Sufficiency and mTOR Regulate p70 S6 Kinase and eIF-4E BP1 through a Common Effector Mechanism. J Biol Chem. 273, 14484-14494.

  33. Lizcano, J. M., Deak, M., Morrice, N., Kieloch, A., Hastie, C. J., Dong, L., Schutkowski, M., Reimer, U., and Alessi, D. R. (2002) Molecular Basis for the Substrate Specificity of NIMA-Related Kinase-6 (NEK6). Evidence that NEK6 does Not Phosphorylate the Hydrophobic Motif of Ribosomal S6 Protein Kinase and Serum- and Glucocorticoid-Induced Protein Kinase in Vivo. J Biol Chem. 277, 27839-27849.

  34. Haren, L., Remy, M. H., Bazin, I., Callebaut, I., Wright, M., and Merdes, A. (2006) NEDD1-Dependent Recruitment of the Gamma-Tubulin Ring Complex to the Centrosome is Necessary for Centriole Duplication and Spindle Assembly. J Cell Biol. 172, 505-515.

  35. Salem, H., Rachmin, I., Yissachar, N., Cohen, S., Amiel, A., Haffner, R., Lavi, L., and Motro, B. (2010) Nek7 Kinase Targeting Leads to Early Mortality, Cytokinesis Disturbance and Polyploidy. Oncogene. 29, 4046-4057.

  36. Greenman, C., Stephens, P., Smith, R., Dalgliesh, G. L., Hunter, C., Bignell, G., Davies, H., Teague, J., Butler, A., Stevens, C., Edkins, S., O'Meara, S., Vastrik, I., Schmidt, E. E., Avis, T., Barthorpe, S., Bhamra, G., Buck, G., Choudhury, B., Clements, J., Cole, J., Dicks, E., Forbes, S., Gray, K., Halliday, K., Harrison, R., Hills, K., Hinton, J., Jenkinson, A., Jones, D., Menzies, A., Mironenko, T., Perry, J., Raine, K., Richardson, D., Shepherd, R., Small, A., Tofts, C., Varian, J., Webb, T., West, S., Widaa, S., Yates, A., Cahill, D. P., Louis, D. N., Goldstraw, P., Nicholson, A. G., Brasseur, F., Looijenga, L., Weber, B. L., Chiew, Y. E., DeFazio, A., Greaves, M. F., Green, A. R., Campbell, P., Birney, E., Easton, D. F., Chenevix-Trench, G., Tan, M. H., Khoo, S. K., Teh, B. T., Yuen, S. T., Leung, S. Y., Wooster, R., Futreal, P. A., and Stratton, M. R. (2007) Patterns of Somatic Mutation in Human Cancer Genomes. Nature. 446, 153-158.

  37. Davies, H., Hunter, C., Smith, R., Stephens, P., Greenman, C., Bignell, G., Teague, J., Butler, A., Edkins, S., Stevens, C., Parker, A., O'Meara, S., Avis, T., Barthorpe, S., Brackenbury, L., Buck, G., Clements, J., Cole, J., Dicks, E., Edwards, K., Forbes, S., Gorton, M., Gray, K., Halliday, K., Harrison, R., Hills, K., Hinton, J., Jones, D., Kosmidou, V., Laman, R., Lugg, R., Menzies, A., Perry, J., Petty, R., Raine, K., Shepherd, R., Small, A., Solomon, H., Stephens, Y., Tofts, C., Varian, J., Webb, A., West, S., Widaa, S., Yates, A., Brasseur, F., Cooper, C. S., Flanagan, A. M., Green, A., Knowles, M., Leung, S. Y., Looijenga, L. H., Malkowicz, B., Pierotti, M. A., Teh, B. T., Yuen, S. T., Lakhani, S. R., Easton, D. F., Weber, B. L., Goldstraw, P., Nicholson, A. G., Wooster, R., Stratton, M. R., and Futreal, P. A. (2005) Somatic Mutations of the Protein Kinase Gene Family in Human Lung Cancer. Cancer Res. 65, 7591-7595.

  38. Wang, R., Song, Y., Xu, X., Wu, Q., and Liu, C. (2013) The Expression of Nek7, FoxM1, and Plk1 in Gallbladder Cancer and their Relationships to Clinicopathologic Features and Survival. Clin Transl Oncol. .

  39. Lamkanfi, M., and Dixit, V. M. (2009) Inflammasomes: Guardians of Cytosolic Sanctity. Immunol Rev. 227, 95-105.