Phenotypic Mutation 'Fenrir'

• Allele: Fenrir
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 88,099,749 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Rab38
• Gene Name: RAB38, member RAS oncogene family
• Synonym(s): 2310011F14Rik
• Chromosomal Location: 88,079,481-88,140,780 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for a spontaneous mutation display oculocutaneous albinism, abnormal lung alveolar structure and aberrant pulmonary surfactant homeostasis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000102877] [ENSMUSP00000146448]
• AlphaFold: Q8QZZ8
• SMART Domains: Protein: ENSMUSP00000102877; Gene: ENSMUSG00000030559; AA Change: I88N

Domain	Start	End	E-Value	Type
RAB	10	180	8.9e-84	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000107256)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
  (Using ENSMUST00000208478)
• Meta Mutation Damage Score: 0.9485
• Is this an essential gene?: Possibly essential (E-score: 0.713)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 036964-MU
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2013-02-06 8:20 PM by Tiana Purrington
• Record Posted: 2014-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Tiana Purrington

Accession Number

NCBI RefSeq: NM_028238.7; MGI: 1919683

Alleles Listed at MGI

All alleles(5) : Targeted(3) Gene trapped(1) Spontaneous(1)

Phenotypic Description

Figure 1. The fenrir mouse has brown fur (top). An unaffected littermate is shown (bottom).

Fenrir was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant with brown fur (Figure 1).

Nature of Mutation

Whole genome HiSeq sequencing of the G1 grandsire identified 61 mutations. FIve G3 mice with the fenrir phenotype (and 23 unaffected mice) were genotyped at all 61 mutation sites and four mutations on chromosome 7 were homozygous in all five of the fenrir mice. The mutation in Rab38 (LOD = 3.29) was presumed to be causative because the fenrir hypopigmentation phenotype mimics other known alleles of Rab38 (see MGI for a list of Rab38 alleles). Capillary sequencing of the mutated genes identified a T to A transversion at base pair 88450541 (v38) on Chromosome 7 in the GenBank genomic region NC_000073 encoding Rab38. The mutation corresponds to residue 263 in the mRNA sequence within exon 2 of 3 total exons.

247 GCTATGGGGGCATTTATTGTTTTTGATGTCACC

83  -A--M--G--A--F--I--V--F--D--V--T-

The mutated nucleotide is indicated in red.  The mutation results in a conversion of Isoleucine (I) to Asparagine (N) at position 88 (I88N) in the Rab38 protein. 

Protein Prediction

Figure 2. Domain structure of Rab38.  The six consensus GTP-binding sequences and the isoprenylation motif (CAKS) are shown at the top.  Three of the GTP-binding sequences are involved in guanine (G1-G3) binding; the other three sequences are involved in phosphate/Mg²⁺ (PM1-PM3) binding. The positions of the RabF motifs (green) and RabSF motifs (pink) for Rab38 indicated; the gray bar indicates overlap.  The fenrir mutation (shown by the red asterisk) is an isoleucine to an asparagine conversion at amino acid 88.

Rab38 encodes the highly conserved [human/rat (96.2%), human/mouse (93.8%), rat/mouse (95.2%)] 24 kDa Rab guanosine triphosphatase (GTPase), Rab38 [Figure 2; (1-3); reviewed in (4)]. The Rab proteins comprise the largest family within the Ras superfamily of small GTPases [see the record for concrete for information about Rab27a; reviewed in (4)]. Like all Ras superfamily proteins, Rab38 contains the six consensus sequences that mediate GTP-binding of Rabs [reviewed in (4;5)].  Three sequences are involved in guanine (G1-G3) binding [G1 = F; G2 = nKXD;  G3 = EXSA; X is any amino acid], the other three sequences are involved in phosphate/Mg²⁺ (PM1-PM3) binding [PM1 = GXXXXGKs; PM2 = T; PM3 = DXXG] (6) [see Figure 2 for the locations of the PM/G motifs in Rab38]. The presence of five motifs designated as Rab family motif (RabF) 1-5 distinguishes the Rab proteins from other small GTPases (5).  The RabF motifs are thought to mediate the interaction of the Rab proteins with Rab-specific regulators (e.g., Rab escort proteins (REP) and GDP dissociation inhibitors (RabGDI) [reviewed in (4)].  The RabF motifs cluster in and around the switch I and II regions [reviewed in (4)]. Small GTPases have switch I and switch II regions that change conformation as a GTPase switches between the GTP- and GDP-bound states [reviewed in (4)]. The prototypical amino acid sequences of the RabF motifs (and their corresponding location in the folded protein) are as follows: RabF1, IGVDF (loop 2 - β2, in the switch I region); RabF2, KLQI/LW (β3); RabF3, RFRSIT (loop 4); RabF4, YYRGA (α2-loop 5); RabF5, LVY/FDIT (β4-loop 6) (5). RabF2-F5 cluster in and around switch II (between sheets β3 and β4) (5).

Four regions designated Rab subfamily motif (RabSF) 1-4 share high amino acid sequence identity among Rabs of the same subfamily. The RabSF regions are proposed to determine binding specificity to effectors, and to thus reflect functional similarity among members of a subfamily (7).

Prenylation is essential for Rab function in that it facilitates the localization of Rab proteins to specific cellular membranes. Most Rab proteins contain a C-terminal di-cysteine motif (e.g., XXXCC, XXCCX, XCCXX, CCXXX or XXCXC; C is cysteine and X is any amino acid) where both cysteines are modified by prenylation (i.e., the covalent addition of either geranylgeranyl (20-carbon) or farnesyl (15-carbon) isoprenoids via thioether linkages) (8;9). Other Rab proteins (e.g., Rab13, Rab23, Rab18, and Rab38) have a CAAX motif (A is an aliphatic residue) that is modified by a single geranylgeranyl moiety (10). Proteins with a C-terminal CAAX motif are prenylated by CAAX prenyltranserases (either farnesyltransferase or geranylgeranyltransferase type I) (11). When X is a methionine, serine, glutamine, or alanine, the substrate is farnesylated, whereas if it is a leucine or phenylalanine, the substrate is geranylgeranylated (11). The Rab geranylgeranyltransferase (RGGT, also known as geranylgeranyltransferase type II) specifically modifies Rab proteins that are in complex with the accessory protein Rab escort protein (REP), which also delivers prenylated Rabs to their target membrane (12). 

Rabs containing only a single C-terminal cysteine are sometimes carboxyl methylated, thereby increasing the hydrophobicity of the protein.  The same pathway is utilized by CAAX-containing Rab, Ras and Rho GTPases.  After prenylation, RGGT dissociates and the AAX peptide is proteolytically cleaved by CAAX  prenyl protease 2 (RCE1).  The exposed prenylated cysteine is subsequently carboxyl methylated by ICMT (isoprenylcysteine carboxyl methyltransferase) at the ER membrane (11). For Ras proteins, carboxymethylation promotes the correct membrane association of the protein.  In contrast, carboxymethylation of Rab proteins appears to affect only the distribution of the protein between membrane and cytosol.  Although Rab38 was methylated in vitro, Rab38 was not carboxyl methylated in cells, indicating that Rab38 may not be a good RCE1 substrate in vivo (11). Subsequent site-directed mutagenesis to introduce a valine or leucine at the A₂ position (lysine in CAKS) resulted in Rab38 methylation in vivo, indicating that the A₂ position is an important determinant of RCE1-mediated proteolysis (11).

Figure 3. Crystal structure of rat Rab3A. Rab3A (aa 18-186) bound to nonhydrolyzable GTP analog GppNHp. The switch regions, Rab family motifs (RabF), and Rab subfamily motifs (RabSF) are labeled. Image is interactive, click to rotate. Figure based on PDB: 3RAB and a figure found in (13).

Although the crystal structure of Rab38 has not been solved, the Rab proteins share similar overall folds and Rab3A has been used as a model for the Rab proteins (13). The active form of rat Rab3A (amino acids 18-186) bound to nonhydrolyzable GTP analog GppNHp has been solved to 2.0 Å [Figure 3; PDB: 3RAB; (13)]. The 19-residue N-terminus is sensitive to proteolysis and was not included in the crystal structure (13). Rab3A consists of a six-stranded β-sheet comprised of five parallel strands and one antiparallel strand surrounded by five α-helices (13). The active conformation of Rab3A is stabilized by hydrophobic contacts between the switch I and II regions (13). Highly conserved serine residues in the phosphate-binding loop (P loop) and switch I interact with the γ-phosphate of GTP (13). Furthermore, these serine residues help stabilize the active conformation of the switch regions (13). The switch I-β2 region (⁵¹FVSTVGIDFKV⁶¹) is highly conserved in exocytic Rabs (13). Thr54 (the underlined residue, above) mediates the interaction with the γ-phosphate (13). Several residues C-terminal to Thr54 are conserved among the Rab proteins and are analogous to the ‘effector-binding loop’ in Ras (⁵⁴T(I/V)G(I/V/A)(D/E)F⁵⁹) (13). The β3-switch II region contains the highly conserved sequence ⁷⁶WDTAGQER(Y/F)RTIT(S/T)(A/S)YYRGA⁹⁵ and contains the DxxG motif common to all GTP binding proteins (13). The active conformation of Rab3A is mediated by interactions between the γ-phosphate of GTP and Thr54 in switch I and Gly80 in switch II (14).

The fenrir mutation results in the conversion of isoleucine 88 to an asparagine. Any changes in Rab38 expression and/or activity due to the mutation are unknown.

Expression/Localization

Rab38 is expressed in mouse melanocytes, retinal pigment epithelial cells, alveolar pneumocytes, and platelets (2;15;16). Quantitative PCR of rat organs determined that the highest expression of Rab38 in the rat is in the lung, followed by skin, stomach, kidney, and liver (16).  Whole-mount in situ analysis showed that Rab38 is expressed as early as embryonic day (E) 11.5 in melanocytes of the retinal pigment epithelium (RPE) (1).

Western blot for the rat Rab38 protein confirmed the mRNA expression pattern within lysosome-related organelle (LRO)-producing cells (i.e., melanocytes, platelets, and lung alveolar type (AT) II epithelial cells) (15-18). LROs share features with lysosomes, contain some lysosomal proteins, and have a low luminal pH. In the Brown Norway (BN) rat, Rab38 expression was detected in the kidney, heart and liver in addition to melanocytes, platelets, ATII cells and lung Clara cells (2). In mouse tissues, Rab38 was expressed in bone marrow mast cells and basophil-derived rat basophil leukemia (RBL) cells and at lower levels in lung and ATII–derived MLE-12 cells (18). Rab38 was not detected in mouse liver, brain, spleen, kidney, bone marrow dendritic cells, RAW (macrophage), AR42J (exocrine pancreas), MIN6 and INS-1 (insulinoma), or in AtT20 (anterior pituitary) cells (18). Observed differences in Rab38 localization in the liver and kidney between the rat and mouse have not been addressed.

Immunostaining of rat liver revealed that hepatocytes were stained for Rab38, while Glisson capsules were not (16). Within rat kidney, proximal renal tubular epithelial cells, but not the glomerulus were immunoreactive for Rab38 (16).  Immunostaining for Rab38 in ATII cells revealed that Rab38 was distributed throughout the cytoplasm and colocalized with the ER resident protein BiP/GRP78; Rab38 did not colocalize with the Golgi and trans-Golgi network (17). Cell fractionation and imaging of EGFP-tagged Rab38 in isolated ATII cells showed that Rab38 targets to the limiting membranes of a subpopulation of lamellar bodies (19).  Immunofluorescence staining of Rab38 in a differentiated megakaryocytic (i.e., bone marrow cells) line (Dami cells) detected perinuclear localization as well as punctate cytoplasmic staining attributed to granules (2). Rab38 partially colocalizes with Rab32, AP-3 complex, and clathrin in primary megakaryocytes and a human megakaryocytic cell line (MEG-01) [(20); for information about the relationship between Rab38 and these proteins, see “Background”, below]. Further analysis determined that Rab38 partially colocalized with Lamp-3, a protein localized to dense granules and lysosomes in resting platelets, and Lamp-1, a LRO marker (2).

In melanocytes, Rab38 was localized at the cell periphery (i.e., in mature pigmented melanosomes) and vesicular structures in the perinuclear region (1;18). Confocal immunofluorescence revealed that Rab38 (and Rab32) colocalize with AP-1, AP-3, and BLOC-2 complexes, in MNT-1 melanocytes (21;22). Rab38 and Rab32 associate with AP-3, AP-1, and BLOC-2 on the membranes, not in the cytosol, indicating that the GTP-bound form of the Rabs function in the assembly of the melanosome complexes (21). Rab38 and Rab32 are proposed to localize to specific tubular domains of early/recycling endosomes that contain AP-1, AP-3, or BLOC-2 (20;21;23).

Background

For an overview of Rab GTPases please see the record for concrete.

Figure 4. Rab38 and the trafficking of proteins to lysosomal-related organelles (LROs) from the trans-Golgi network (TGN). BLOC-1 and AP-3 mediate early steps of vesicle trafficking from the early endosome, while BLOC-2 and BLOC-3 are involved in later stages. For simplicity, only the major cargo proteins affected by each HPS complex are shown (ATP7A, tyrosinase, Tyrp1, LAMP1). ATP7a in maturing melanosomes allows the influx of copper and activates tyrosinase. BLOC-1 also binds to the vesicle fusion protein syntaxin 13, which is localized to the stage I melanosome/coated endosome. BLOC-2 and AP-3 interact with clathrin. Melanosomal maturation is shown separately. During melanosome maturation, Rab32, Rab38, and Tyrp1 are necessary for the processing and trafficking of tyrosinase, a protein necessary for pigment production (inset).

Rab38 function in melanosomes

Rab38, similar to other members of the RAB GTPase family, regulates intracellular vesicle trafficking [Figure 4; (16)]. Rab38 and 32 are highly homologous [Rab32 is 67% identical to Rab38 (18)] and have somewhat redundant functions in melanocytes (and other cells where LROs are present) [(15;18;21;24); reviewed in (25;26)]. Rab38 functions in the delivery of enzymes to the maturing melanosome in both skin melanocytes and in RPE cells (24). Rab38 and Rab32 cooperate with BLOC-2, AP-1 and AP-3 to assist tyrosinase [Tyr; see the records for ghost, pale rider, and siamese] and Tyr-related protein 1 [Tyrp1; (see the record for chi)]-containing vesicles from the trans-Golgi network to end-stage melanosomes in skin melanocytes and RPE cells to produce pheomelanins (yellow or red) and eumelanin (brown or black) pigment [(1;18;21;22;27;28); reviewed in (29)]. Deficiency in both Rab38 and Rab32 result in enhanced Tyrp1 recycling through the plasma membrane; Rab38 depletion does not lead to loss of Tyrp2 (Dct) expression, but Rab32 deficiency does (21). Rab38 also interacts with Varp, a guanine nucleotide exchange factor for Rab21, to facilitate the trafficking of Tyrp1 in melanocytes [(28;30); reviewed in (26)].

Rab38 functions in kidney, lung, and platelet dense granules

Rab38 functions in tubular reuptake and processing of filtered proteins in the proximal tubule of the rat kidney (3). The Fawn-Hooded Hypertensive (FHH) rat model carries a Rab38 mutation that results in a premature stop codon at codon one; the next in-frame ATG is in the second exon (2;15;31;32). Protein expression analysis by Western blot revealed no Rab38 protein expression in FHH tissues (2). The FHH model exhibits hypertension, proteinuria, and albuminuria and subsequently develop end-stage renal disease (3;33). Rescuing Rab38 expression in a Brown Norway (BN) strain expressing mutant Rab38 resulted in significant improvement in both proteinuria and albuminuria compared to levels observed in the FHH model (3;33).

Mutations in Rab38 lead to disruption in surfactant homeostasis in lung ATII cells as well as increased susceptibility to lung pathologies (e.g., interstitial pneumonia) and altered lung alveolar structures in both mice and rats (34;35). Rescue experiments in the FHH model revealed that Rab38 functions in regulating lamellar body morphology in ATII cells (19). Lamellar bodies, LROs in ATII cells, contain (and subsequently release once fused to cell membranes) surfactant proteins that function to lower alveolar surface tension, maintaining alveolar lumen in an open and relatively dry state (34).

Platelet dense granules (DGs) are storage organelles in platelets and contain ATP, ADP, serotonin, pyrophosphate, calcium, membrane-bound P-selectin (CD62P) and lysosomal-associated membrane protein (Lamp)-3 (CD63) (2). DGs are essential in platelet aggregation, adhesion and secretion in response to vascular injury (2). siRNA-mediated knockdown of Rab38 in the MEG-01 human megakaryocytic cell line led to deficient tethering or fusion (or both) of early endosomal cargo-containing vesicles with the immature DG  (20).

RAB38 is considered to be a Hermansky-Pudlak Syndrome (HPS)-related locus

Defects in the trafficking of LROs due to mutations in genes associated with LRO biogenesis [e.g., HPS1, AP3 (see the record for bullet gray), HPS6 (see the record for stamper-coat), HPS3 (see the records for pam gray), HPS5 (see the record for dorian gray), CHS1 (see the record for souris), MYO5A (see the record for new gray), and RAB27A (see the record for concrete)] result in HPS I-III, conditions in which patients can exhibit oculocutaneous albinism, bleeding diathesis, and progressive interstitial pneumonia (20;35;36). Although RAB38 mutations in human HPS patients have not been identified, it is considered to be an HPS-related locus (36-38).

Putative Mechanism

Several Rab38 mutant rodent models exhibit defective LRO biogenesis and are considered phenotypic models of HPS (1;15;18;32;35;36). The spontaneous mouse mutation chocolate (cht; Gly19Val; MGI: 1856819) is within the GTP-binding domain of Rab38 (1;2;15). Although the mutant Rab38 protein can still bind GTP, it is not prenylated and results in an inactive, unstable, and exclusively cytosolic protein (1;15;18;24;39). Homozygous cht mice exhibit oculocutaneous albinism characterized by a brown coat color, iris and RPE thinning, as well as altered homeostasis of lung surfactant, and aberrant ATII cell morphology; the cht mice do not exhibit platelet storage deficiency (15;24;34;36). The cht mice develop emphysematous lung disease (34;39). Quantification of Tyr in immature and mature melanosomes of the RPE determined that Tyr levels were reduced, indicating that Tyr delivery was defective in the cht eye (24). In addition, end-stage melanosomes from cht melanocytes expressed less Tyrp1 than control melanocytes, indicating that the cht mutation also impairs Tyrp1 sorting (1;36).

Several Rab38 mutant rat models have also been identified including ruby (R), FHH, and Cinnamon all of which carry an identical Rab38 mutation that results in a premature stop codon at codon one (2;15;31;32). Similar to cht, these models exhibit oculocutaneous albinism (“fawn” coat color in the FHH model), abnormal lung surfactant homeostasis, and aberrant lamellar body morphology (2;15;35;40). In contrast to cht, the rat models exhibit platelet storage deficiency and a lack of dense granules in megakaryocytes making them closer models of human HPS than the mouse mutants (35).

Similar to the other Rab38 mutant rodent models, fenrir exhibits albinism characterized by a brown coat color; eye color change in fenrir has not been observed. Although Rab38, Tyr, and Tyrp1 protein expression and localization have not been examined in fenrir, defects in the transport of Tyr and/or Tyrp1 are suspected. Other Rab38-associated phenotypes have not been studied and/or observed in fenrir.

Primers

PCR Primer
Fenrir_pcr_F: CGGCAAGAGCCTACAACTGTTGAAC
Fenrir_pcr_R: TTGCAGAACTGGTCCATCTTGAGTC

Genotyping

Fenrir genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

PCR Primers

Fenrir(F): 5’-CGGCAAGAGCCTACAACTGTTGAAC-3’

Fenrir(R): 5’-TTGCAGAACTGGTCCATCTTGAGTC-3’

 
Sequencing Primer

Fenrir_seq(R): 5’-GAGTCCATTGTTCATAAGCACATCC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 505 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Rab38) is amplified:

19945                           cggcaa gagcctacaa ctgttgaact atcttcaagg    

19981 cccaataatc aactacctat tttttaaaaa ttaaattttc atttctggtt gtaaatatta    

20041 aacaacatag ctacataaat gtatatttta ttctgtctct aaatattagc attaaaactt    

20101 tctattgcat cacctgatca tttggggggg atatgaagct ccagtgtagt gtacaattat    

20161 gattctaatt ttagtaactt agtgaattct gtctcttttt gctgacaggt caagaaagat    

20221 ttggaaacat gacaagagtt tattaccggg aagctatggg ggcatttatt gtttttgatg    

20281 tcaccagacc agccacattt gaagccgtgg caaagtggaa aaatgatttg gactcaaagt    

20341 taacgctccc taatggtaag ccagtgtcag tggttctgtt ggccaacaaa tgtgaccaag    

20401 ggaaggatgt gcttatgaac aatggactca agatggacca gttctgcaa

Primer binding sites are underlined and sequencing primer is highlighted; the mutated T is shown in red text.

References

  1. Loftus, S. K., Larson, D. M., Baxter, L. L., Antonellis, A., Chen, Y., Wu, X., Jiang, Y., Bittner, M., Hammer, J. A.,3rd, and Pavan, W. J. (2002) Mutation of Melanosome Protein RAB38 in Chocolate Mice. Proc Natl Acad Sci U S A. 99, 4471-4476.

  2. Ninkovic, I., White, J. G., Rangel-Filho, A., and Datta, Y. H. (2008) The Role of Rab38 in Platelet Dense Granule Defects. J Thromb Haemost. 6, 2143-2151.

  3. Rangel-Filho, A., Lazar, J., Moreno, C., Geurts, A., and Jacob, H. J. (2013) Rab38 Modulates Proteinuria in Model of Hypertension-Associated Renal Disease. J Am Soc Nephrol. 24, 283-292.

  4. Pereira-Leal, J. B., and Seabra, M. C. (2001) Evolution of the Rab Family of Small GTP-Binding Proteins. J Mol Biol. 313, 889-901.

  5. Pereira-Leal, J. B., and Seabra, M. C. (2000) The Mammalian Rab Family of Small GTPases: Definition of Family and Subfamily Sequence Motifs Suggests a Mechanism for Functional Specificity in the Ras Superfamily. J Mol Biol. 301, 1077-1087.

  6. Valencia, A., Chardin, P., Wittinghofer, A., and Sander, C. (1991) The Ras Protein Family: Evolutionary Tree and Role of Conserved Amino Acids. Biochemistry. 30, 4637-4648.

  7. Moore, I., Schell, J., and Palme, K. (1995) Subclass-Specific Sequence Motifs Identified in Rab GTPases. Trends Biochem Sci. 20, 10-12.

  8. Leung, K. F., Baron, R., and Seabra, M. C. (2006) Thematic Review Series: Lipid Posttranslational Modifications. Geranylgeranylation of Rab GTPases. J Lipid Res. 47, 467-475.

  9. Lane, K. T., and Beese, L. S. (2006) Thematic Review Series: Lipid Posttranslational Modifications. Structural Biology of Protein Farnesyltransferase and Geranylgeranyltransferase Type I. J Lipid Res. 47, 681-699.

  10. Joberty, G., Tavitian, A., and Zahraoui, A. (1993) Isoprenylation of Rab Proteins Possessing a C-Terminal CaaX Motif. FEBS Lett. 330, 323-328.

  11. Leung, K. F., Baron, R., Ali, B. R., Magee, A. I., and Seabra, M. C. (2007) Rab GTPases Containing a CAAX Motif are Processed Post-Geranylgeranylation by Proteolysis and Methylation. J Biol Chem. 282, 1487-1497.

  12. Alexandrov, K., Horiuchi, H., Steele-Mortimer, O., Seabra, M. C., and Zerial, M. (1994) Rab Escort Protein-1 is a Multifunctional Protein that Accompanies Newly Prenylated Rab Proteins to their Target Membranes. EMBO J. 13, 5262-5273.

  13. Dumas, J. J., Zhu, Z., Connolly, J. L., and Lambright, D. G. (1999) Structural Basis of Activation and GTP Hydrolysis in Rab Proteins. Structure. 7, 413-423.

  14. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) The GTPase Superfamily: Conserved Structure and Molecular Mechanism. Nature. 349, 117-127.

  15. Brooks, B. P., Larson, D. M., Chan, C. C., Kjellstrom, S., Smith, R. S., Crawford, M. A., Lamoreux, L., Huizing, M., Hess, R., Jiao, X., Hejtmancik, J. F., Maminishkis, A., John, S. W., Bush, R., and Pavan, W. J. (2007) Analysis of Ocular Hypopigmentation in Rab38cht/cht Mice. Invest Ophthalmol Vis Sci. 48, 3905-3913.

  16. Osanai, K., Takahashi, K., Nakamura, K., Takahashi, M., Ishigaki, M., Sakuma, T., Toga, H., Suzuki, T., and Voelker, D. R. (2005) Expression and Characterization of Rab38, a New Member of the Rab Small G Protein Family. Biol Chem. 386, 143-153.

  17. Osanai, K., Iguchi, M., Takahashi, K., Nambu, Y., Sakuma, T., Toga, H., Ohya, N., Shimizu, H., Fisher, J. H., and Voelker, D. R. (2001) Expression and Localization of a Novel Rab Small G Protein (Rab38) in the Rat Lung. Am J Pathol. 158, 1665-1675.

  18. Wasmeier, C., Romao, M., Plowright, L., Bennett, D. C., Raposo, G., and Seabra, M. C. (2006) Rab38 and Rab32 Control Post-Golgi Trafficking of Melanogenic Enzymes. J Cell Biol. 175, 271-281.

  19. Zhang, L., Yu, K., Robert, K. W., DeBolt, K. M., Hong, N., Tao, J. Q., Fukuda, M., Fisher, A. B., and Huang, S. (2011) Rab38 Targets to Lamellar Bodies and Normalizes their Sizes in Lung Alveolar Type II Epithelial Cells. Am J Physiol Lung Cell Mol Physiol. 301, L461-77.

  20. Ambrosio, A. L., Boyle, J. A., and Di Pietro, S. M. (2012) Mechanism of Platelet Dense Granule Biogenesis: Study of Cargo Transport and Function of Rab32 and Rab38 in a Model System. Blood. 120, 4072-4081.

  21. Bultema, J. J., Ambrosio, A. L., Burek, C. L., and Di Pietro, S. M. (2012) BLOC-2, AP-3, and AP-1 Proteins Function in Concert with Rab38 and Rab32 Proteins to Mediate Protein Trafficking to Lysosome-Related Organelles. J Biol Chem. 287, 19550-19563.

  22. Bultema, J. J., and Di Pietro, S. M. (2013) Cell Type-Specific Rab32 and Rab38 Cooperate with the Ubiquitous Lysosome Biogenesis Machinery to Synthesize Specialized Lysosome-Related Organelles. Small GTPases. 4, 16-21.

  23. Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 Interacts with BLOC-2 and the AP-3 Complex to Facilitate Protein Trafficking on Endosomes 2. Mol Biol Cell. 17, 4027-4038.

  24. Lopes, V. S., Wasmeier, C., Seabra, M. C., and Futter, C. E. (2007) Melanosome Maturation Defect in Rab38-Deficient Retinal Pigment Epithelium Results in Instability of Immature Melanosomes during Transient Melanogenesis. Mol Biol Cell. 18, 3914-3927.

  25. Fukuda, M. (2008) Regulation of Secretory Vesicle Traffic by Rab Small GTPases. Cell Mol Life Sci. 65, 2801-2813.

  26. Ohbayashi, N., and Fukuda, M. (2012) Role of Rab Family GTPases and their Effectors in Melanosomal Logistics. J Biochem. 151, 343-351.

  27. Tamura, K., Ohbayashi, N., Ishibashi, K., and Fukuda, M. (2011) Structure-Function Analysis of VPS9-Ankyrin-Repeat Protein (Varp) in the Trafficking of Tyrosinase-Related Protein 1 in Melanocytes. J Biol Chem. 286, 7507-7521.

  28. Tamura, K., Ohbayashi, N., Maruta, Y., Kanno, E., Itoh, T., and Fukuda, M. (2009) Varp is a Novel Rab32/38-Binding Protein that Regulates Tyrp1 Trafficking in Melanocytes. Mol Biol Cell. 20, 2900-2908.

  29. Sarangarajan, R., and Boissy, R. E. (2001) Tyrp1 and Oculocutaneous Albinism Type 3. Pigment Cell Res. 14, 437-444.

  30. Wang, F., Zhang, H., Zhang, X., Wang, Y., Ren, F., Zhang, X., Zhai, Y., and Chang, Z. (2008) Varp Interacts with Rab38 and Functions as its Potential Effector. Biochem Biophys Res Commun. 372, 162-167.

  31. Datta, Y. H., Wu, F. C., Dumas, P. C., Rangel-Filho, A., Datta, M. W., Ning, G., Cooley, B. C., Majewski, R. R., Provoost, A. P., and Jacob, H. J. (2003) Genetic Mapping and Characterization of the Bleeding Disorder in the Fawn-Hooded Hypertensive Rat. Thromb Haemost. 89, 1031-1042.

  32. Oiso, N., Riddle, S. R., Serikawa, T., Kuramoto, T., and Spritz, R. A. (2004) The Rat Ruby ( R) Locus is Rab38: Identical Mutations in Fawn-Hooded and Tester-Moriyama Rats Derived from an Ancestral Long Evans Rat Sub-Strain. Mamm Genome. 15, 307-314.

  33. Rangel-Filho, A., Sharma, M., Datta, Y. H., Moreno, C., Roman, R. J., Iwamoto, Y., Provoost, A. P., Lazar, J., and Jacob, H. J. (2005) RF-2 Gene Modulates Proteinuria and Albuminuria Independently of Changes in Glomerular Permeability in the Fawn-Hooded Hypertensive Rat. J Am Soc Nephrol. 16, 852-856.

  34. Osanai, K., Oikawa, R., Higuchi, J., Kobayashi, M., Tsuchihara, K., Iguchi, M., Jongsu, H., Toga, H., and Voelker, D. R. (2008) A Mutation in Rab38 Small GTPase Causes Abnormal Lung Surfactant Homeostasis and Aberrant Alveolar Structure in Mice. Am J Pathol. 173, 1265-1274.

  35. Osanai, K., Higuchi, J., Oikawa, R., Kobayashi, M., Tsuchihara, K., Iguchi, M., Huang, J., Voelker, D. R., and Toga, H. (2010) Altered Lung Surfactant System in a Rab38-Deficient Rat Model of Hermansky-Pudlak Syndrome. Am J Physiol Lung Cell Mol Physiol. 298, L243-51.

  36. Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., and Kuhn, R. (2012) Modeling Disease Mutations by Gene Targeting in One-Cell Mouse Embryos. Proc Natl Acad Sci U S A. 109, 9354-9359.

  37. Di Pietro, S. M., and Dell'Angelica, E. C. (2005) The Cell Biology of Hermansky-Pudlak Syndrome: Recent Advances. Traffic. 6, 525-533.

  38. Wei, M. L. (2006) Hermansky-Pudlak Syndrome: A Disease of Protein Trafficking and Organelle Function. Pigment Cell Res. 19, 19-42.

  39. Osanai, K., and Voelker, D. R. (2008) Analysis and Expression of Rab38 in Oculocutaneous Lung Disease. Methods Enzymol. 438, 203-215.

  40. Itagaki, S., Shimamoto, S., Hirano, T., Iseki, K., Sugawara, M., Nishimura, S., Fujimoto, M., Kobayashi, M., and Miyazaki, K. (2004) Comparison of Urinary Excretion of Phenolsulfonphthalein in an Animal Model for Wilson's Disease (Long-Evans Cinnamon Rats) with that in Normal Wistar Rats: Involvement of Primary Active Organic Anion Transporter. J Pharm Pharm Sci. 7, 227-234.