Phenotypic Mutation 'Orange' (pdf version)
AlleleOrange
Mutation Type critical splice donor site (1 bp from exon)
Chromosome1
Coordinate87,697,546 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Inpp5d
Gene Name inositol polyphosphate-5-phosphatase D
Synonym(s) s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
Chromosomal Location 87,620,312-87,720,507 bp (+)
MGI Phenotype Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration and defective cytolysis by NK cells and CTLs.
Accession Number

NCBI RefSeq: NM_010566; NM_001110192, NM_001110193; MGI: 107357

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000044647] [ENSMUSP00000072763] [ENSMUSP00000126569] [ENSMUSP00000131244] [ENSMUSP00000127941] [ENSMUSP00000132384]
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category decrease in B cells, decrease in IgD+ B cells, decrease in IgM+ B cells
Penetrance  
Alleles Listed at MGI

All alleles(62) : Targeted(7) Gene trapped(53) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 unclassified probably damaging 1.00
Sailing UTSW 1 87705964 missense
styx UTSW 1 87669784 critical splice donor site
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice acceptor site noncoding transcript
R0733:Inpp5d UTSW 1 87668077 splice donor site probably benign
R1464:Inpp5d UTSW 1 87698105 splice acceptor site
R1464:Inpp5d UTSW 1 87698105 splice acceptor site
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4774:Inpp5d UTSW 1 87620617 missense silent
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense probably benign 0.02
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice
Repository

MMRRC:37623

Last Updated 09/06/2017 1:05 PM by Diantha La Vine
Record Created 02/07/2013 11:47 PM by Ming Zeng
Record Posted 12/19/2014
Phenotypic Description

Figure 1. Orange mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Orange mice exhibit a decreased percentage of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Orange mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The orange phenotype was initially identified among G3 mice of the pedigree R0010, some of which showed a decrease in the frequency of B cells (Figure 1) including IgD+ (Figure 2) and IgM+ B cells (Figure 3), all in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of reduced B cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R0010.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Inpp5d: G to A transition at base pair 87697546 (v38) on chromosome 1, or base pair or 77,235 in the GenBank genomic region, NC_000067 encoding Inpp5d. The strongest association was found with a recessive model of linkage to the reduced B cell frequency, wherein 6 affected variant homozygotes departed phenotypically from 14 homozygous reference mice and 13 heterozygous mice with a P value of 2.3737 x 10-6 (Figure 4). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

Figure 5. RT-PCR analysis of Inpp5d in blood from the orange mice. (A)  Inpp5d cDNA and primer binding sites used in RT-PCR and sequencing. The forward primer was designed upstream of the orange mutation in exon 10 and the reverse primer downstream of the orange mutation within exon 14. The forward sequencing primer is in exon 10. (B) RT-PCR results using the primers shown in (A).

RT-PCR and sequencing analysis were used to examine Inpp5d splicing in orange tissues. Using primers spanning exons 10-14 (5’-CTAAACAAGTTGGTGATTTTGGTGG-3’; 5’-CATTGAACATGAAGGACACTCCCA-3’) (Figure 5A), RT-PCR of blood mRNA showed two Inpp5d PCR amplicons in the homozygous orange mouse compared to the wild-type mouse (Figure 5B). Sequence analysis determined that the cDNA amplified from orange blood contained a 197-base pair deletion corresponding to exon 12 (out of 27 total exons) in the cDNA transcript ENSMUST00000169754, indicating that the orange mutation abolishes the function of the intron 12 donor splice site. Aberrant splicing results in skipping of exon 12  and the out of frame deletion of the 65 amino acids (amino acids 418-482) encoded by exon 12, resulting in coding of a premature stop codon within exon 13 (amino acid 436 in the wild-type protein).  

 

                            <--exon 11  <--exon 12 intron 12-->   exon 13-->
1324  AAAAGAGAA…AACATGG……ATTTAAAACA GTGAGCAGCT……………AGAGCATGAGAATCG 1688
383   -K--R--E-…-N--M--……--F--K--T-                -R--A--*        436
          CORRECT         DELETED                  ABERRANT

 

The donor splice site of intron 12, which is destroyed by the orange mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.

Protein Prediction
Figure 6. Domain structure of SHIP protein isoforms. SHIPβ and SHIPδ arise from alternative splicing that occurs adjacent to the first NPXY motif. SHIPβ arises from in-frame splicing, while SHIPδ arises from out-of-frame splicing that results in an alternative C-terminal domain. The sSHIP isoform has an alternative promoter. The SH2 containing isoforms have been shown to be expressed in differentiated hematopoietic cells, mouse embyronic fibroblasts (MEF) and vascular endothelial cells. The sSHIP isoform is expressed by embryonic stem (ES) cells and HSC. Full-length SHIP is also expressed in HSC. Other potential isoforms have been described (not shown). The orange mutation alters the donor splice site of intron 12 and is proposed to destroy the reading frame in the middle of the encoded SHIP-1 polypeptide chain (aberrant amino acids after position 416), and subsequently creating a premature stop codon that would truncate the protein after amino acid 436. The pink box indicates the portion of the SHIP-1 protein encoded by exon 12. Image is interactive; click to view other mutations of SHIP-1. 

Inpp5d encodes SHIP-1, an 1191-amino acid Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase (Figure 6). Two of SHIP-1 isoforms (SHIPβ and SHIPδ) have C-terminal alterations that remove potential SH3-domain binding regions and disrupt a potential binding site for the p85 subunit of phosphatidylinositol 3-kinase (PI3K). One of the SHIP isoforms (sSHIP) does not utilize the intron 5 donor splice site.  Instead, this sequence uses an alternative promoter found in intron 5 to add an extra nine amino acids to the protein sequence coded by exons 6-27.  Thus, this isoform is missing the N-terminal SH2 domain and the amino acid sequence deleted by the styx mutation, but is able to interact with Grb2.  Aberrant splicing of the Inpp5d transcript due to the orange mutation would result in a truncated protein that would not contain the inositol polyphosphate 5-phosphatase motifs, two NPXY motifs, and the C-terminal proline-rich domain with several SH3 binding motifs (Figure 6). The orange mutation would affect all of the SHIP isoforms.

 

Please see the record styx for information about Inpp5d.

Putative Mechanism

In hematolymphoid cells, SHIP can be recruited to a wide variety of receptor complexes including growth factor receptors and immune receptors. SHIP is recruited to receptor-associated signaling complexes via adaptors (e.g. Shc, Grb2, Dok3), scaffold proteins like Gab1 or directly via its SH2 domain. After recruitment to the plasma membrane, SHIP can then hydrolyze PIP3. Hydrolysis of PIP3 inhibits recruitment of PH domain containing kinases like Akt, Btk (Bruton’s tyrosine kinase), and phospholipase C (PLC)-γ to the plasma membrane and thus limits the activity of several different PI3K effectors that promote cell survival, migration, differentiation or proliferation. These include distal kinases like MAP/ERK, JNK/SAPK, p38 MAPK and key transcription factors such as NF-κB and NFAT.

 

The orange mice exhibit reduced levels of B cells similar to Inpp5d knockout mice [MGI:2386884; (1;2)] and myeloid-specific conditional knockout mice [MGI:3715983; (3)]. The changes in B cell number was attributed to high levels of the cytokine interleukin-6 (IL-6), which directly contributes to the reduced level of B cells seen in these mice as IL-6 is known to inhibit B cell development while enhancing myeloid cell development (1). In addition to the expansion of other myeloid cell types, SHIP-deficient animals carry large numbers of myeloid suppressor cells that are potent antagonists of allogeneic T cell activation by host APCs in vitro (4). In addition, SHIP-deficient T cells do not produce a type 2 T helper (Th2) response, which is important in determining B cell antibody class switching, when exposed to the proper stimuli (5). An ENU-induced model with a mutation in Inpp5d [Iso651Thr; MGI:5050823; (6)] exhibited decreased levels of double-positive thymocytes and a reduced number of circulating lymphocytes. This study determined that a SHIP1 isoform expressed in stem and progenitor cells (s-SHIP), and lost upon the ENU-induced mutation, is necessary for SHIP1 function in hematopoiesis (6).

Primers PCR Primer
Orange(F):5'- TTGCTGTTGAAGGTAATGCACCCC -3'
Orange(R):5'- TTTGGAACCCTGAACATGCACCCC -3'

Sequencing Primer
Orange_seq(F):5'- CAAGAAGATCACGTCCTGGTTTC -3'
Orange_seq(R):5'- ctcaaactcagaaatccgcc -3'
Genotyping

Orange genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

PCR Primers

Orange(F): 5’- TTGCTGTTGAAGGTAATGCACCCC-3’

Orange(R): 5’- TTTGGAACCCTGAACATGCACCCC-3’

 
Sequencing Primer

Orange_seq(F): 5’- CAAGAAGATCACGTCCTGGTTTC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 726 nucleotides (from Genbank genomic region NC_000067 for linear DNA sequence of Inpp5d) is amplified:

 

77026                                                  ttgct gttgaaggta    

77041 atgcaccccc tcccaagaag atcacgtcct ggtttctctc caaggggcag ggaaagacac    

77101 gggacgactc tgctgactac atcccccatg acatctatgt gattggcacc caggaggatc    

77161 cccttggaga gaaggagtgg ctggagctac tcaggcactc cctgcaagaa gtcaccagca    

77221 tgacatttaa aacagtgagc agctggccag gcctggggtg ggaagacagc agactctttc    

77281 aagcattcca gaagtcagac aggatacttc caaagatgta taggattgct caggggtacc    

77341 ccactttcag agccacagat gtgcattgag gtggcaccct tacaagttga tagggtcctg    

77401 agtccgccat cttccctact cctgcttaaa agaataatat cgccgggcgt ggtggtgcac    

77461 gcctttaatc ccagcactcg ggaggcagag gcaggcggat ttctgagttt gaggccagcc    

77521 tggtctacaa agtgaattcc agggcagcca gggctataca gagaaaaaac caaaaagaaa    

77581 agaaaaagaa taatatttac ttcctagatg cattttcagt cccagttctc atctctgagg    

77641 tgctttgtct catttctagg cattgttgga agttccccct gaaagctagg aaatacagac    

77701 agggtgtctt actcccaggg tggaaccggg gtgcatgttc agggttccaa a

 

Primer binding sites are underlined; the mutated T is shown in red text.

 

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsMing Zeng, Kuan-Wen Wang, Bruce Beutler