Phenotypic Mutation 'shook' (pdf version)
Alleleshook
Mutation Type nonsense
Chromosome16
Coordinate91,499,537 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ifnar1
Gene Name interferon (alpha and beta) receptor 1
Synonym(s) Ifar, Ifrc, IFN-alpha/betaR
Chromosomal Location 91,485,238-91,507,441 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit increased susceptibility to viral infection, elevated levels of myeloid lineage cells in the peripheral blood and bone marrow, and reduced immune response to immunostimulatory DNA.
Accession Number

NCBI RefSeq: NM_010508.2; MGI: 107658

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000023689]
PDB Structure
Murine Ifnar1 in complex with interferon-beta [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000023689
Gene: ENSMUSG00000022967
AA Change: Q309*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category impaired response to dsDNA- type I IFN production by macrophages
Penetrance  
Alleles Listed at MGI

All alleles(10) : Targeted(5) Gene trapped(4) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ifnar1 APN 16 91489782 missense probably benign 0.06
IGL02183:Ifnar1 APN 16 91505146 missense possibly damaging 0.90
IGL02828:Ifnar1 APN 16 91505416 splice site 0.00
macro-1 UTSW 16 91499885 missense possibly damaging 0.56
R0124:Ifnar1 UTSW 16 91499537 nonsense probably null
R0502:Ifnar1 UTSW 16 91501751 missense probably damaging 1.00
R0617:Ifnar1 UTSW 16 91501682 missense probably damaging 1.00
R1509:Ifnar1 UTSW 16 91503496 missense probably damaging 1.00
R4111:Ifnar1 UTSW 16 91496158 missense probably damaging 1.00
R4473:Ifnar1 UTSW 16 91495170 missense probably damaging 0.98
R4964:Ifnar1 UTSW 16 91505086 missense probably benign 0.08
R5497:Ifnar1 UTSW 16 91505364 missense probably benign 0.01
X0057:Ifnar1 UTSW 16 91495424 missense probably damaging 0.98
X0057:Ifnar1 UTSW 16 91505283 missense possibly damaging 0.92
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 036965-MU
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 02/08/2013 12:08 AM by Hexin Shi
Record Posted 07/18/2013
Phenotypic Description
Figure 1. Shook peritoneal macrophages were defective in producing type I interferon (IFN) in response to dsDNA (red dots).

Shook was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals in the Double-stranded DNA Macrophage ScreenShook peritoneal macrophages were defective in producing type I interferon (IFN) in response to dsDNA (Figure 1, red dots).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 59 mutations. Four G3 mice with the shook phenotype were genotyped at all 59 mutation sites and two mutations on chromosome 16 were homozygous in all four of the shook mice. Subsequent analysis of five additional affected mice and 21 unaffected mice supported a causal relationship between the mutation and the phenotype (LOD =5.49).  Sequencing of the mutated gene identified a C to T transition at base pair 91499537 (v38) on Chromosome 16 in the GenBank genomic region NC_000082 encoding Ifnar1. The mutation corresponds to residue 1054 in the mRNA sequence (NM_010508.2) within exon 7 of 11 total exons.

 
1039 TTCTTTCTCCATGTACAAGCCTCAGAGGGAAAT

304  -F--F--L--H--V--Q--A--S--E--G--N-

 

The mutated nucleotide is indicated in red.  The mutation results in a glutamine (Q) to premature stop codon (*) substitution at residue 309. 

 

Protein Prediction

Figure 2. Domain structure of IFNAR1. IFNAR1 belongs to the class II helical cytokine receptor (hCR) family. The extracellular ligand-binding region of IFNAR1 contains four fibronectin type III subdomains known as SD1-4. The shook mutation results in a conversion of glutamine to a premature stop codon at residue 309 within the SD3 domain. Image is interactive; click to view other IFNAR1 mutations.

The shook mutation (Q309*) is within the fibronectin type-III subdomain 3 (SD3) of the IFNAR1 protein (Figure 2). It is unknown whether this protein is expressed and localized normally.

 

Please see the record macro-1 for information about Ifnar1.

Putative Mechanism

Shook mice produce significantly reduced amounts of type I IFN in response to dsDNA stimulation of macrophages ex vivo.  This finding suggests that the shook mutation impairs signaling through the IFNAR receptor, thus preventing activation of the positive feedback loop for type I IFN production. 

Primers PCR Primer
shook(F):5'- GGTCCACAGTGCTTACTACAGTGTC -3'
shook(R):5'- CGCCCTACATGAGGAATTACACTCC -3'

Sequencing Primer
shook_seq(F):5'- tgtcttaggtattatagagcctcag -3'
shook_seq(R):5'- gaccacacccacaacctc -3'
Genotyping

Shook genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

PCR Primers

Shook(F): 5’- GGTCCACAGTGCTTACTACAGTGTC-3’

Shook(R): 5’- CGCCCTACATGAGGAATTACACTCC-3’

 
Sequencing Primer

Shook_seq(F): 5’- TGTCTTAGGTATTATAGAGCCTCAG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 496 nucleotides (from Genbank genomic region NC_000082 for linear DNA sequence of Ifnar1) is amplified:

 

14085                                                 ggtcca cagtgcttac    

14101 tacagtgtct taggtattat agagcctcag tacatagtga attaattcat gattggattg    

14161 gattttgttt ttgctttctg ttttcaaagt ggctattcaa aaagcagttc tggaagccgt    

14221 tcagataaat ggaaaccaat accaacctgt gcaaatgtcc agactacgca ctgtgtcttt    

14281 tctcaagata ctgtctacac aggaacgttc tttctccatg tacaagcctc agagggaaat    

14341 cacacatcct tttggtctga agagaagttt attgattctc aaaaacacag taagccgagt    

14401 tttctttgag acagtctgac actgtagccc aggctggcct ggaactcacg gtgtagccca    

14461 gggtagcttc aaacttatgg cagtcctcct gcctgagctc ctgagagctg aggttgtggg    

14521 tgtggtccat gcctgctgta tagcaagcgc tttctggagt gtaattcctc atgtagggcg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C is shown in red text.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsHexin Shi, Ying Wang, Bruce Beutler