Phenotypic Mutation 'mrbig' (pdf version)
Allelemrbig
Mutation Type missense
Chromosome2
Coordinate122,600,744 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Gatm
Gene Name glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Synonym(s) 1810003P21Rik
Chromosomal Location 122,594,467-122,611,303 bp (-)
MGI Phenotype Mice homozygous for a knock-out allele exhibit resistance obesity, reduced adipocity and improved glucose homeostasis when fed a high fat diet.
Accession Number

NCBI Refseq: NM_025961.5; MGI:1914342

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000028624]
SMART Domains Protein: ENSMUSP00000028624
Gene: ENSMUSG00000027199
AA Change: D254G

DomainStartEndE-ValueType
Pfam:Amidinotransf 254 414 3e-7 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000028624)
Phenotypic Category decrease in body weight, DSS: sensitive day 10, DSS: sensitive day 7
Penetrance  
Alleles Listed at MGI

All alleles(3) : Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gatm APN 2 122600825 missense probably benign 0.36
IGL03059:Gatm APN 2 122609700 missense probably damaging 1.00
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R1004:Gatm UTSW 2 122609660 splice donor site
R2088:Gatm UTSW 2 122598148 missense probably benign
R2128:Gatm UTSW 2 122600536 missense probably damaging 1.00
R4027:Gatm UTSW 2 122597446 missense probably damaging 1.00
R4589:Gatm UTSW 2 122595494 missense noncoding transcript
R5155:Gatm UTSW 2 122609853 missense probably benign 0.02
R5183:Gatm UTSW 2 122595503 missense probably benign 0.01
R5517:Gatm UTSW 2 122595543 missense probably damaging 1.00
R5804:Gatm UTSW 2 122602602 missense probably benign 0.00
R5842:Gatm UTSW 2 122603627 missense probably benign
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 03/16/2017 12:54 PM by Katherine Timer
Record Created 02/10/2013 4:33 PM by Emre Turer
Record Posted 02/24/2017
Phenotypic Description
Figure 1. mrbig mice exhibited susceptibility to DSS-induced colitis at day 7. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. mrbig mice exhibited susceptibility to DSS-induced colitis at day 10. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. mrbig mice exhibited less body weights than unaffected littermates. Raw weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. mrbig mice exhibit characteristic symptoms of colitis. (A) Kaplan–Meier survival plot showing that Gatmmb/mb mice (n = 8) exhibit increased mortality after DSS compared with littermate controls [Gatm+/+(n = 8) and Gatmmb/+ (n = 14)]. (B) Colons of mice exposed to 10-d DSS treatment exhibited shortening (n = 3 per genotype). Representative colons (Upper; after DSS treatment) and colon length (Lower). Bars indicate mean ± SD; **P < 0.01. (C) Histologic examination of Gatmmb/mb colons after 7 d of DSS treatment (10× magnification). Figure and legend adapted from (1).

The mrbig phenotype was identified among G3 mice of the pedigree R0046, some of which showed susceptibility to dextran sulfate sodium (DSS)-induced colitis at day 7 (Figure 1) and day 10 (Figure 2) (1). The screen uses weight loss as indication of colitis. Some mice also exhibited reduced body weights and runting compared to control littermates (Figure 3). The mrbig mice also exhibited increased mortality after DSS compared to wild-type controls (Figure 4A) (1). Colons of the mice exposed to DSS for 10 days exhibited shortening (Figure 4B). The colons of the DSS-treated mrbig mice exhibited loss of crypt architecture, a denuded epithelial layer, and prominent inflammatory infiltrates (Figure 4C).

Nature of Mutation

Figure 5. Linkage mapping of the DSS-induced colitis phenotype at day 10 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R0046.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 6. Validation that a mutation in Gatm causes the mrbig phenotype. (A) Weight loss analysis of the Gatmmb/cmice in response to 1.5% DSS. Gatm+/+ (n = 3), Gatmmb/+ (n = 4), Gatmc/+ (n = 5), and Gatmmb/c (n = 5) mice were analyzed on day 8 of treatment. ***P < 0.001. (B) Colons of Gatmmb/c mice exposed to DSS on day 8 of treatment exhibited shortening (n = 5). Gatm+/+ (n = 3) mice were also analyzed. **P < 0.01. (C) Stool scores in Gatmmb/c mice 7 d after administration of 1.5% DSS. Gatm+/+ (n = 3) and Gatmmb/c(n = 5) mice were analyzed. **P < 0.01. Figure and legend adapted from (1).

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. All of the above anomalies were linked to a mutation in Gatm: A to G transition at base pair 122,600,744 (v38) on chromosome 2, or base pair 10,534 in the GenBank genomic region NC_000068.  The strongest association was found with a recessive model of linkage to the raw DSS-induced colitis phenotype at day 7, wherein 6 homozygous variant mice departed phenotypically from 8 homozygous reference mice and 7 heterozygous mice with a P value of 1.78 x 10-14 (Figure 5). The mutation corresponds to residue 822 in the mRNA sequence NM_025961 within exon 5 of 9 total exons.

 

803 GAGTTTGAGCCTTGCTTTGATGCTGCTGACTTCATTCGA
248 -E--F--E--P--C--F--D--A--A--D--F--I--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a aspartic acid (D) to glycine (G) substitution at amino acid 254.

 

The Gatm mutation in mrbig was validated by CRISPR-mediated targeting of Gatm. The Gatm-CRISPR mice exhibited weight loss after treatment with 1.5% DSS as well as colonic shortening and loose stools (Figure 6).

Protein Prediction
Figure 7. Domain structure of mouse AGAT. AGAT consists of a single domain (designated as "SCOP" (Structural Classification of Proteins):d1jdw by SMART, residues 64-423). SMART also identified a single domain designated PDB:3JDWA (aa 1-423); not shown. The mrbig mutation is an aspartic acid (D) to glycine (G) substiution at amino acid 254. TP, transit peptide.

Figure 8. Crystal structure of human AGAT. Figure was generated by PyMOL software and is based on PDB: 1JDW. Cys407, the active site, is highlighted as well as module I (aa 1-171), module II (aa 172-256), module III (aa 257-307), module IV (aa 308-363), and module V (aa 364-423). The residue mutated in mrbig (Asp254) is also denoted. Please see the text for more details. Click on the image for the image to rotate.

Gatm encodes the 423 amino acid precursor protein glycine amidinotransferase (L-arginine:inosamine phosphate amidinotransferase) (AGAT; alternatively, AT; Figure 7). During transport of the precursor protein to the mitochondrial intermembrane space, the 37 N-terminal residues are cleaved to yield a 386 amino acid mature protein [designated as the α-form; (2); reviewed in (3;4)]. A second form of AGAT (designated as the β-form) has been identified in rats and humans [(2); reviewed in (3;4)]. The β-form is proposed to be a product of alternative splicing of Gatm and is 391 amino acids, retaining five of the 37 N-terminal amino acids that are cleaved from the α-form [(2); reviewed in (3;4)].

 

Examination of a recombinant form of human AGAT expressed in E. coli determined that the active site of AGAT is Cys407 (2). AGAT can recognize several substrates, but is specific for natural L-amino acids including arginine, glycine, ornithine, and guanidinoacetate [reviewed in (4)]. Other substrates can act as amidine (i.e., oxoacid derivative) donors (e.g., canavanine, hydroxyguanidine, 4-guanidinobutyrate, 3-guanidinopropionate (GPA), and homoarginine) or acceptors (e.g., canaline, hydroxylamine, glycylglycine, 1,4-diaminobutylphosphonate, 4-aminobutyrate (GABA), 3-aminopropionate, and β-alanine) (5-7).

 

The crystal structure of mature human AGAT (residues 38-423) has been solved [PDB: 1JDW; (8)Figure 8]. AGAT folds into a compact single domain structure. Viewing the structure from the bottom, the AGAT protein has 5-fold pseudosymmetry built up from five modules consisting of (β)βαβ-motifs circularly arranged around the 5-fold symmetry axis. The first two strands of the β-sheet of each module are antiparallel, while the third strand is parallel to the second strand. Module I is comprised of the N-terminus and amino acid (aa) residues 64-171, module II is aa 172-256, module III is aa 257-307, module IV is aa 308-363, and module V is aa 364-423. Insertions of 10 helices and two-stranded antiparallel β sheets (strands S3 and S4 in module I) connect the modules. Helices H2 and H9 form insertions into modules I and II. Coil regions of modules I, III, and IV form a narrow channel that leads to Cys407. The X-ray structures of AGAT in complex with the amidino acceptor glycine (PDB:5JDW) as well as in complex with several amidino acceptor and donor analogs have also been solved (9). During the enzyme reaction cycle, AGAT adopts open and closed conformations (9). Upon binding of L-arginine and L-ornithine, AGAT undergoes large conformational changes compared to the structure of the enzyme without ligand (8;9). Comparison of the crystal structures of AGAT bound to glycine versus the amidino acceptor analogs γ-aminobutyric acid (PDB:6JDW) and δ-aminovaleric acid (PDB:7JDW) or to the crystal structures of AGAT bound to the amidino donor analogs L-alanine (PDB: 8JDW), L-α-aminobutyric acid (PDB:9JDW), and L-norvaline (PDB: 1JDX) revealed different binding modes, reflecting broad substrate specificity for AGAT (9). Ligand-free AGAT and AGAT in complex with the amidino acceptor or analogs glycine, γ-aminobutyric acid, and δ-aminovaleric acid were in closed conformation while the AGAT bound to L-arginine or L-ornithine were in open conformation (9).

 

The mrbig mutation is at amino acid 254 within module II (aa 172-256; Figure 7); this module is not involved in the channel that leads to the active site (i.e., Cys407). The functional significance of this residue (or the surrounding residues) is unknown.

Expression/Localization

Gatm mRNA is expressed at low levels in the lung, high levels in the kidney, and intermediate levels in the brain, skeletal muscle, and heart (10). Within the brain, Gatm mRNA is expressed in neurons, astrocytes, and oligodendrocytes (11).

 

Immunofluorescence microscopy detected large amounts of AGAT in the rat kidney, pancreas, and liver (12;13). AGAT activity has been detected predominantly in the kidney and pancreas, with lower levels in the liver, heart, lung, muscle, spleen, brain, testis, and thymus (4;14).  In rats, the highest level of AGAT activity was detected in the decidua of pregnant females compared to other tissues; AGAT is absent from human placenta (7). In the human and rat kidney, AGAT is confined to the cortex (15). Within the nephron, AGAT activity and immunoreactivity are restricted to epithelial cells of the proximal convoluted tubule (13;16). In rat liver, AGAT is localized near the central vein and the portal triad within the cytoplasm (13). Other studies have reported that the livers of cow, pig, monkey, and human have high amounts of AGAT, but the livers of rat, mouse, dog, cat, and rabbit lack AGAT activity [reviewed in (4)]. Within the pancreas, AGAT is localized to the acinar cells (17). The α-form of AGAT is localized to the mitochondria, while the β- form is localized to the cytoplasm [(2); reviewed in (3)]. In most tissues examined (i.e., rat pancreas, rat kidney, chicken liver), mitochondrial localization was observed (7;18).

 

The expression profiles of Gatm mRNA and AGAT protein have been examined during rat development in embryos at embryonic day (E) 12.5, E15.5, and E18.5 (12). AGAT was detected in all parts of the central nervous system at E12.5, with highest levels in the middle part of somites, in the hepatic primordium, and in the wall of the dorsal aorta (12). At E15.5, increased levels of AGAT were detected in isolated cells throughout the brain, but AGAT was expressed in most regions of the central nervous system (12). In addition, high levels of AGAT were detected in skeletal muscles, primordial of gonads, and caudal somites (12). At E18.5, Gatm mRNA is expressed in most regions of the CNS; high levels were detected in the endothelial cells of the developing cerebral capillaries (12). Both mRNA and protein levels were high in skeletal muscle, kidney, and pancreas; lower levels were found in the liver and intestine epithelial cells (12).

 

Examination of the mouse embryo determined that the highest level of Gatm is expressed from E7.5-E9.5 in samples that contained a mixture of embryonic and extraembryonic tissue (14). From E10.5-E18.5, Gatm levels are expressed exclusively in embryonic tissue at relatively low levels; expression gradually increases throughout development (14)Gatm is expressed exclusively from the maternal allele in extraembryonic tissues in Mus musculus during development, but is biallelic in other tissues (14). At E9.5, Gatm is maternally expressed in the yolk sac, but biallelic in the embryo (14). In the human placenta, GATM is not a product of genomic imprinting (19;20).

 

Increased creatine serum levels results in a decrease in Gatm expression as well as the enzymatic activity of AGAT (14;18).  In contrast, folic acid deficiency results in a decrease in creatine serum levels and an upregulation in Gatm expression. AGAT enzyme activity can also be inhibited allosterically by ornithine [reviewed in (3)]. Gatm mRNA expression is induced by growth hormone and thyroxine (21). Removal of all or part of the thyroid gland (i.e., a thyroidectomy) or the pituitary gland (i.e., a hypophysectomy) in rat results in decreased AGAT activity in the kidney; injection of thyroxine or growth hormone can restore AGAT activity in the thyroid and pituitary, respectively [(21;22); reviewed in (4)]. However, the injections did not alter AGAT enzyme activity in the kidney, indicating that both hormones function to maintain AGAT activity in the rat kidney [(21;22); reviewed in (4)]. Thyroid and growth hormones regulate AGAT expression at the pretranslational level (21;22). Sex hormones can also control AGAT levels in rat kidney, testis, and decidua: estrogens and diethylstilbestrol decreased AGAT levels, while testosterone increased AGAT levels (7;23). Diet and disease (e.g., fasting, protein-free diets, vitamin E deficiency, or in streptozotocin (STZ)-induced diabetes) result in decreased AGAT levels in the liver, pancreas, and kidney [(24;25); reviewed in (4)]. In fasting and vitamin E deficiency, creatine levels are increased in the serum, likely leading to the downregulation of AGAT (26;27).

Background
Figure 9. Creatine metabolism. Although most creatine is found in muscle, it can not synthesize creatine. AGAT functions in the first step of creatine synthesis in the kidney to catalyze the formation of guanidoacetic acid (GAA). In the liver, GAMT subsequently facilitates the methylation of GAA to form creatine via the transfer to a methyl group from S-adenosyl-L-methionine (SAM) to GAA. SLC6A8 (not shown) takes up creatine at the target organs from the blood. Muscular creatine and creatine phosphate are converted to creatinine, which diffuses out of the cells is excreted by the kidneys into the urine.

Creatine biosynthesis is essential to maintain energy homeostasis by functioning to replenish ATP in vertebrates, especially in the central nervous system and muscles (4;7;12;28). Creatine is continually degraded to creatinine, which necessitates dietary creatine intake and/or endogenous creatine synthesis (28). Creatine biosynthesis occurs as a two-step process mainly in the kidney, pancreas, and liver [Figure 9; reviewed in (4;7)]. In the first (and rate-limiting) step, AGAT catalyzes the transfer of an amidino group from arginine to glycine to form ornithine and guanidinoacetate (GuA) in the kidney [(9;14;28); reviewed in (3)]. In the second step, GuA N-methyltransferase (GAMT) methylates GuA to form creatine after the transport of GuA to the liver (4;9;14;28). Creatine is actively transported to the organs (e.g., muscle, nerve tissue, and myocardium) by the blood and taken up via SLC6A8, the creatine transporter (10;12;28;29).

 

AGAT function and the heart

Examination of genes differentially regulated in samples taken at LVAD implantation and explantation from patients that underwent therapy and recovered determined that GATM mRNA levels were increased in failing hearts (at the time of implantation) compared to normal hearts (10). In addition, GATM gene expression was significantly downregulated during recovery when compared to levels at implantation (10). In samples taken after recovery, GATM mRNA levels returned to comparable levels to that of donors (10).

 

AGAT can also use lysine instead of glycine as an amidino acceptor, resulting the formation of homoarginine instead of GuA (30;31). Low plasma level of homoarginine is linked to cardiovascular disease and is now considered a risk factor of the disease (29). Lymphoblasts from a GATM-deficient patient were unable to synthesize homoarginine from arginine and lysine (29). In contrast, in a lymphoblast cell line, homoarginine was newly synthesized from arginine and lysine (29).

 

AGAT deficiency

Mutations in GATM are linked to AGAT deficiency (OMIM: # 612718), an autosomal recessive disorder that is characterized by severe depletion of creatine/phosphocreatine in the brain, developmental delay/regression, mental retardation, muscle weakness, low weight, and disturbance of expressive and cognitive speech [(28;32-36); reviewed in (3)]. Mutations in other proteins in the creatine pathway [i.e., GAMT; OMIM: #612736 and SLC6A8; OMIM: #300352] can also cause creatine deficiency syndromes (37;38). Supplementation of creatine in patients with AGAT deficiency can lead to improvement in clinical features of the syndrome.  For example, a three-week old patient with AGAT deficiency was treated with creatine supplementation at four months and exhibited normal development at 18 months (39). In another study, three patients with AGAT deficiency were treated with oral creatine supplementation and exhibited increased cerebral creatine levels and improvement of abnormal developmental scores (33;34). Although improvement was noted, the two patients continued to have moderate intellectual deficiency.

 

Gatm mouse models

A mouse model homozygous for a knockout allele of Gatm (MGI:5465452) exhibits female and male infertility (due to impaired spermatogenesis) as well as decreased creatine, creatinine, and guanidine acetate levels in the urine, decreased circulating leptin levels, decreased circulating cholesterol, decreased circulating triglyceride, reduced locomotor activity during the active dark period, reduced body mass index, scoliosis, and lower body weight due to reduced fat content (28). Homozygotes exhibited increased glucose clearance through GLUT4 in skeletal muscle and white adipose tissue as well as a decreased circulating insulin level after glucose challenge when fed a high fat diet; levels were normal under fasted conditions (28). Homozygotes also exhibited impaired gluconeogenesis in the liver and improved glucose tolerance (28). In addition, homozygotes fed a high fat diet exhibited a decreased susceptibility to diet-induced obesity, decreased subcutaneous adipose tissue, decreased white adipose tissue, and decreased total body fat amount (28). Homozygotes have overall decreased body weight after four weeks, decreased body mass index (BMI), and decreased body length (28). However, mice supplemented with phosphorylated creatine exhibit normal body length, body weight, BMI, and body composition (28). Choe et al. propose that the metabolic deficiencies observed in the knockout model are mediated by a chronic activation of AMP-activated protein kinase (AMPK) in skeletal muscle, adipose tissue, brain, and liver (28).

Putative Mechanism
Figure 10. Colonic epithelium of Gatmc/c mice exhibit reduced proliferation and increased cell death during DSS treatment. (A) Images of TUNEL staining (green) of colon sections from Gatm+/+ and Gatmc/c mice on day 4 of 1.5% DSS treatment (20× magnification); images are representative of three independent experiments. Quantification was performed on a minimum of 50 crypts for Gatm+/+ (n = 3) and Gatmc/c (n = 3) colons. *P < 0.05. (B) Metabolic labeling of DNA in Gatm+/+ and Gatmc/c colons on day 4 of 1.5% DSS treatment. EdU-labeled DNA was stained with Click-iT EdU labeling Alexa Fluor 647 (20× magnification); images are representative of at least three independent experiments. Quantification was performed on a minimum of 50 crypts for Gatm+/+ (n = 5) and Gatmc/c (n = 5) colons. *P < 0.05. Figure and legend adapted from (1).

Colonic epithelium from Gatm-deficient mice exhibited reduced proliferation and increased cell death during DSS treatment (Figure 10). The failure to regenerate the colonic epithelium in the mrbig (and Gatm-deficient) mice is due to a loss in ATP-dependent intracellular signaling (1).

Primers PCR Primer
mrbig(F):5'- CTCGATGCCCAGGTAGTTTGTAACC -3'
mrbig(R):5'- TGCTTTCCTTAACCCAATCAGATCAGC -3'

Sequencing Primer
mrbig_seq(F):5'- GTTTGGAAAACCAAAAGTGTGCAG -3'
mrbig_seq(R):5'- GTTAGAATTGATCATCGCGGACC -3'
Genotyping
Chromosome + strand trace file of the mrbig mutation (T>C).

Mrbig genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

PCR Primers

mrbig_PCR_F: 5’-CACTCGATGCCCAGGTAGTTTGTAAC-3’

mrbig_PCR_R: 5’-TGCTTTCCTTAACCCAATCAGATCAGC-3’

 

Component

Amount (μl)

template (tail DNA)

2

primer (1) (10 μM)

2

primer (2) (10 μM)

2

JumpStart ReadyMix

25

dd Water

19

total

50

 

PCR program
1) 95°C 3:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 2:00
5) repeat steps (2-4) 40X
6) 72°C 7:00
7) 4°C ∞

 

Primer for sequencing

mrbig_Seq_F: 5’- GTTTGGAAAACCAAAAGTGTGCAG -3’

 

The following sequence of 520 nucleotides is amplified (Chr. 2: 122600518-122601037, GRCm38; NC_000068):

 

cactcgatgc ccaggtagtt tgtaacctga aataaaataa aattaaaaaa aaaatctttt         

aaaaagtcca ttctaagttt ggaaaaccaa aagtgtgcag aatctaaaag ttgttaattt      

aggaatagag aatgcaatga tgtaggtgag atttcagagc cagcctttag caacctggct      

tctctgtgca aaaatatctc ttccagctcg aatgaagtca gcagcatcaa agcaaggctc      

aaactcagtc gtcacgaact ttccctgagc ggccaatttg tgtctgtctt ccacggaatg      

gatgggataa ttctagttgg aacaagaaca aacacacaca atgcatttat tttttaatga      

acttatttac aaggatatac ttgattttaa aaattagtta gctcaatacc accattttcc      

aaagtactac caatcaactc ttgattcaaa cacccataga aaagatattg gtccgcgatg      

atcaattcta acagctgatc tgattgggtt aaggaaagca

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is indicated in red (T>C, Chr. + strand (shown); A>G, sense strand).

References
  4. Pisano, J. J., Abraham, D., and Udenfriend, S. (1963) Biosynthesis and Disposition of γ-Guanidinobutyric Acid in Mammalian Tissues. Arch Biochem Biophys. 100, 323-329.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsEmre Turer