Phenotypic Mutation 'csp' (pdf version)
List |< first << previous [record 95 of 511] next >> last >|
Allelecsp
Mutation Type missense
Chromosome19
Coordinate5,747,688 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Ltbp3
Gene Name latent transforming growth factor beta binding protein 3
Synonym(s) Ltbp2
Chromosomal Location 5,740,904-5,758,532 bp (+)
MGI Phenotype Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels.
Accession Number

NCBI RefSeq: NM_008520; MGI: 1101355

Mapped Yes 
Amino Acid Change Cysteine changed to Arginine
Institutional SourceBeutler Lab
Ref Sequences
C452R in Ensembl: ENSMUSP00000080214 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 284 326 5.9e-8 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 410 451 9.5e-17 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 1.1e-15 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1096 1135 4.6e-10 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.67; Specificity: 0.97)
(Using Ensembl: ENSMUSP00000080214)
Phenotypic Category craniofacial, growth/size, limbs/digits/tail phenotype, skeleton phenotype
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(3) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.43
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice donor site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice acceptor site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1738:Ltbp3 UTSW 19 5753919 splice acceptor site probably benign
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2258:Ltbp3 UTSW 19 5748662 splice acceptor site probably benign
R2260:Ltbp3 UTSW 19 5748662 splice acceptor site probably benign
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.05
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 unclassified probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, gDNA
MMRRC Submission 010463-UCD
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 10/10/2007
Phenotypic Description
The csp (craniofacial and skeletal malformation with paralysis) phenotype is characterized by watery eyes, hind leg paralysis and craniofacial malformations that are evident two weeks after birth. Kyphosis develops gradually, becoming prominent by the age of six months. Csp  homozygotes suffer retarded growth at a young age, but grow normally at later stages.  Histological analyses reveal abnormal formation of synchondroses. These phenotypes are observed both on the C57BL/6J background and in mice created by outcrossing to C3H/HeJ and backcrossing to the mutant stock.
 
The abnormalities observed in csp mice are similar to those of mice with impaired transforming growth factor-β (TGF-β) signaling in skeletal tissue (1).

 

Nature of Mutation
The csp mutation was mapped to Chromosome 19, and corresponds to a T to C transition at position 2343 of the Ltbp3 transcript, in exon 9 of 28 total exons.
 
2328 GCCTTCAAGGAGATCTGCCCGGCTGGGAAAGGG
447  -A--F--K--E--I--C--P--A--G--K--G-
 
The mutated nucleotide is indicated in red lettering, and causes a cysteine to arginine substitution at residue 452 of the LTBP3 protein.
Protein Prediction
Ltbp3 encodes the latent transforming growth factor-β binding protein-3 (LTBP3), an extracellular matrix (ECM) protein thought to regulate signaling by transforming growth factor-β (TGF-β) by regulating its bioavailability. There are 4 LTBPs, and all possess sequence and structural homology to the fibrillins, secreted ECM proteins (2-4). The 1268 amino acid LTBP3 polypeptide contains several motifs divided between five structurally distinct domains (2). After a 21-amino acid N-terminal signal peptide, Domain 1 is a 28-amino acid basic region. Domain 2 consists of two EGF-like repeats, a 135-amino acid proline- and glycine- rich region, a fibrillin motif, and an 8-Cysteine motif (8-Cys; also called a TGF-bp repeat). Domain 3 is a proline-rich region. Domain 4 consists of twelve EGF-like repeats and two 8-Cys motifs. Domain 5 is a unique 22-amino acid C-terminal segment (2). Of the fourteen total EGF-like repeats in LTBP3, eleven contain a calcium binding consensus sequence (2), which has been suggested to confer resistance to proteolytic cleavage (5).
 
The 8-Cys motifs are unique to LTBPs, and mediate covalent binding through a disulfide bond to latent TGF-βs (see Background) (6;7). The NMR solution structure of the 8-Cys motif of fibrillin suggests that hydrophobic contacts may be important for LTBP recognition of latent TGF-β (8). As in all the LTBPs, only the third 8-Cys motif of LTBP3 forms disulfide bonds with latent TGF-β1 (9-11). Notably, the second 8-Cys motif has nine cysteine residues instead of eight, but the biological significance of this is unknown (9). A critical cysteine residue (C33) in latent TGF-β1 participates in disulfide bond formation with LTBP3 (6;10;11).
 
The csp mutation substitutes an arginine for the wild-type cysteine at residue 452 (C452R), in the predicted Domain 4.
Expression/Localization
During embryonic development, mouse Ltbp3 mRNA is expressed throughout the body, with relatively high expression in the liver at embryonic day 13.5. Expression is also detectable in heart, central nervous system, pancreas, kidney, skin and walls of large arteries (2). In addition, Ltbp3 transcript is found in osteoblasts and periosteal cells of the calvarium (top of skull), mandible, and maxilla, and in cartilage and bone of lower extremities (2). The LTBP3 protein is targeted to the cell surface for secretion, a process that reportedly requires complex formation with TGF-β1 (10;12).
Background
TGF-βs are dimeric polypeptide cytokine growth factors expressed and secreted by virtually every cell type. There are three TGF-β isoforms (1-3), each encoded by a separate gene whose expression is developmentally and spatially regulated. TGF-βs regulate cell growth and differentiation, and the synthesis, degradation, and remodeling ofthe extracellular matrix (ECM). They are expressed during embryogenesis and adulthood, and thus contribute to a wide variety of biological processes, including embryonic development, wound healing, angiogenesis, inflammation, and bone formation [reviewed in (13;14)]. TGF-βs generally promote tissue growth and differentiation in the embryo, but inhibit cellular proliferation in mature tissues (15). Dysregulated TGF-β signaling leads to cancers, particularly pancreatic and colon carcinomas (13;15).
 
TGF-βs are secreted from cells as latent large molecular mass complexes (LLCs) with three distinct components. TGF-β molecules are initially synthesized as precursor proteins (proTGF-β) comprised of a propeptide and the mature TGF-β (16). Even after cleavage, a non-covalent attachment binds the propeptide to the mature TGF-β, and in this state the propeptide is termed the latency associated peptide (LAP). The LTBPs form disulfide linkages with LAP at specific cysteine residues (6;7). Together, the LAP, LTBP and TGF-β form the LLC, and in this complex, TGF-β possesses no biological activity. LAP functions as an inhibitor of TGF-β, and dissociation from LAP is a crucial regulatory step in TGF-β activation. This dissociation may be stimulated by several proteases (plasmin, MMP-1, MMP-2), thrombospondin-1, integrins, acidic pH conditions, and reactive oxygen species [reviewed in (14)].
 
The role of LTBPs in TGF-β signaling is not yet clearly defined, although studies of LTBP1 suggest that they serve to localize TGF-β at appropriate sites in the ECM in a regulated manner, thereby modulating TGF-β bioavailability (17). ProTGF-β that fails to bind LTBP-1 is inefficiently secreted, and contains increased numbers of abnormal disulfide bonds, suggesting that LTBP-1 promotes correct folding and subsequent secretion of the LLC (18). Antibodies against LTBP-1 block TGF-β activation in a smooth muscle/endothelial cell coculture system (19), and prevent the TGF-β-stimulated endothelial-mesenchymal transition of mouse heart cultures (20). LTBP-1 may promote TGF-β bioavailability in part through crosslinking of LTBP-1 to the ECM (4;21). Both LTBP-1 and TGF-β are found in ECM microfibrils of fibroblasts (22) and skin cells (23). Moreover, inhibition of transglutaminase, a factor that mediates LTBP1-ECM crosslinking (24;25), reduces production of active TGF-β (26).
 
Once activated, TGF-β binds to three high-affinity cell surface receptors (types I, II and III) [reviewed in (13)]. The type III receptor is a nonsignaling receptor, and transfers its TGF-β ligand to either type I or type II receptors, which signal through their serine/threonine kinase domains and activate targets including the Smad transcription factors, MAP kinase and stress-activated protein (SAP) kinase pathways (13).
Putative Mechanism
Mice with targeted deletion of LTBP3 have been generated, and like csp mice, Ltbp3-/- mice display defects in skull and long bone development and homeostasis (27;28). Ltbp3-/- mice have craniofacial abnormalities, with a rounded head and shortened snout visible by 10 days of age.  Ltbp3-/- mice develop a domed skull, abnormal apposition of upper and lower incisors, and thoracic kyphosis by 2 months of age (27). These defects are caused by premature ossification of the synchondroses of the skull base (which normally never ossify), forcing the membranous bones of the vault to expand outward and upward to accommodate the increasing volume of the developing brain (27).
 
Mislocalized and unchecked chondrocyte differentiation may underlie the premature ossification of synchondroses observed in Ltbp3-/- and csp mice (Figure 2). TGF-β1 has been shown to stimulate the expression of parathyroid hormone related protein (PTHrP, an inhibitor of chondrocyte differentiation) and inhibit chondrocyte hypertrophic differentiation (29;30). In Ltbp3-/- synchondroses, PTHrP levels are reduced relative to wild type, while the expression of Indian hedgehog (Ihh, a marker for chondrocytes committed to hypertrophic differentiation) was detected throughout LTBP3-null synchondroses. These data suggest that LTBP3 promotes TGF-β signaling to limit chondrocyte differentiation and synchondrosis ossification (28).
 
LTBP3-null mice develop age-dependent osteosclerosis with increased bone mass in the long bones and the axial skeleton (28). Similarly, transgenic mice expressing a dominant negative type II TGF-β receptor in osteoblasts acquire age-dependent osteopetrosis (31). Ltbp3-/- mice also develop osteoarthritis, and likewise transgenic mice expressing dominant negative type II TGF-β receptor in skeletal tissue (1), or targeted Smad3 mutants (32). These findings further support the postulate that reduced TGF-β signaling, particularly through Smad3, causes the skeletal phenotypes in Ltbp3-/- and csp mice.
Primers Primers cannot be located by automatic search.
Genotyping
Csp genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Csp(F): 5’-AGAAGCAACTGGGCAGAGGGACATAGC -3’
Csp(R): 5’-TGGTTCTCAACCTTCCCAGTGCCAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:20
4) 68°C             1:00
5) repeat steps (2-4) 35X
6) 68°C             5:00
7) 4°C              ∞
 
Primers for sequencing
Csp_seq(F): 5’- ACCCTCTGACCACACGCCTAAC -3’
Csp_seq(R): 5’- TGTAGCCCTGGCTGTCCTGGAACTC -3’
 
The following sequence of 923 nucleotides (from Genbank genomic region NC_000085 for linear DNA sequence of Ltbp3) is amplified:
 
6446                            agaag caactgggca gagggacata gcaatgctca
6481 ggtcctgccc tccactccca cccctgcagc cgacaaacca gaggagaaga gcctgtgttt
6541 ccgccttgtg agcaccgaac accagtgcca gcaccctctg accacacgcc taacccgcca
6601 gctctgctgc tgtagtgtgg gtaaagcctg gggtgcccgg tgccagcgct gcccggcaga
6661 tggtacaggt gaggcagagg cacatcgtgg atgatgtagg gatgggacgg caagctgtgt
6721 acccgtccag gagttcactt gttgtggtgt ctgcatcttg accacagcag ccttcaagga
6781 gatctgcccg gctgggaaag ggtaccatat cctcacctcc caccagacgc tcaccatcca
6841 gggggaaagc gacttctccc tcttcctgca ccccgacggg ccacccaaac cccagcagct
6901 tcctgaaagc cccagccgag caccacccct cgaggacaca gaggaagaga gaggtctggc
6961 ttgatccaat aattccagat ccacagataa aactcagggg ctagccgggc gtggtggcgc
7021 acgcctttaa tcccagcact tgggaggcag aggcaggcgg atttctgagt tcgaggccag
7081 cctggtctac agagtgagtt ccaggacagc cagggctaca cagagaaacc ctgtcttgaa
7141 aaaaaagact catgggctaa ggcagtggtt tgaaacctgt aggttggaac ccctgggggc
7201 agggggtgtc acatatcaga tatcctgcct atcagatatt tacattagga ctcagaacag
7261 tagcaaaatt acagttatga agtagcaatt agatgatttt atggctgggg agtcatcaca
7321 acatgaggaa ctgtagaaaa ggggtggcac tgggaaggtt gagaacca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Eva Marie Y. Moresco
AuthorsXin Du, Koichi Tabeta, Bruce Beutler
List |< first << previous [record 95 of 511] next >> last >|
Edit History
02/02/2011 11:44 AM (current)
01/07/2011 9:02 AM
12/28/2010 11:28 AM
02/03/2010 9:19 AM