Phenotypic Mutation 'naoki'

• Allele: naoki
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 75,068,774 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Myo5a
• Gene Name: myosin VA
• Synonym(s): flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
• Chromosomal Location: 74,978,297-75,130,970 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008] ; PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000116028] [ENSMUSP00000122773 ^†] [ENSMUSP00000120444] [ENSMUSP00000117493] † probably from a misspliced transcript
• AlphaFold: Q99104
• PDB Structure: Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000116028; Gene: ENSMUSG00000034593; AA Change: R659C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000123128)
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000120444; Gene: ENSMUSG00000034593; AA Change: R659C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000136731)
• SMART Domains: Protein: ENSMUSP00000117493; Gene: ENSMUSG00000034593; AA Change: R659C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000155282)
• Meta Mutation Damage Score: 0.9746
• Is this an essential gene?: Probably essential (E-score: 0.958)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 038247-MU
• Last Updated: 2016-12-08 10:48 AM by Anne Murray
• Record Created: 2013-04-25 2:12 PM by Adam Dismang
• Record Posted: 2014-03-28
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Adam Dismang, Tiana Purrington.

Accession Number

NCBI RefSeq: NM_010864.2; MGI: 105976

Alleles Listed at MGI

All alleles(94) : Targeted(3) Gene trapped(3) Spontaneous(53) Chemically induced(24) Radiation induced(12)

Phenotypic Description

Figure 1. The naoki mice have a gray coat and exhibit opisthotonus.

Naoki was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant (Figure 1). The naoki homozygous mice have a gray coat. The naoki homozygous mice also have a neurological phenotype in that they have trouble righting themselves and exhibit opisthotonus, a form of tetanic spasm in which the head, neck, and spine are bent backward.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations. Six G3 mice with the naoki phenotype were genotyped at all 70 mutation sites and two mutations on chromosome 9 (in Rora and Myo5a) were homozygous in all six mice. Analysis of both mutation sites in 20 unaffected mice determined that all mice were either heterozygous or wild-type for the mutations in Rora (LOD=11.557) and Myo5a (LOD=11.567). Because mutations in Myo5a (e.g., MGI:1856007, MGI:1856005, silver decerebrate, and silver decerebrate 2) have been documented to cause both pigmentation and neurological phenotypes that mimic naoki, the mutation in Myo5a was presumed to be causative for the naoki phenotype. The mutation in Myo5a is a C to T transition at base pair 75,161,492 (v38) on Chromosome 9, or 90,287 in the GenBank genomic region NC_000075 encoding Myo5a. The mutation corresponds to residue 2,402 in the mRNA sequence NM_010864 within exon 16 of 41 total exons.

2384 ACTACTCCTCACTATGTACGCTGTATTAAGCCTAATGAT 653  -T--T--P--H--Y--V--R--C--I--K--P--N--D-

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to cysteine (C) substitution at amino acid 659 in the myosin Va protein.

Protein Prediction

Figure 2. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The naoki mutation is a arginine (R) to cysteine (C) substitution at amino acid 659 (red asterisk). This image is interactive. Click on the image to view other phenotypic (red) and incidental (blue) mutations found in Myo5a; the incidental mutations are designated by the G1 number (e.g., R0047). Click on the mutations for more specific information.

The naoki mutation (R659C) is within the head region (amino acids 1-887) of myosin Va.

Please see the record new gray for information about Myo5a.

Putative Mechanism

Null mutations of Myo5a cause both coat color and neurological phenotypes, because they affect both neuronal- and skin-specific isoforms of Myo5a (1-4). Other mutations, including missense mutations, splice site mutations, and insertions, affect both brain and skin isoforms and fall into two classes: those that cause only coat color phenotypes, and those that cause both coat color and neurological phenotypes (new gray, nut, silver decerebrate, silver decerebrate 2) (5;6). The naoki mutation occurs in the myosin Va head region, which is not alternatively spliced in brain versus skin and should therefore affect both tissues; the mutation causes both coat color and neurological phenotypes. Notably, the naoki and silver decerebrate mutations both cause pigmentation and neurological phenotypes and affect head region amino acids only 34 amino acids apart (R659 and S693, respectively) (Figure 2). The new gray mutation is at M515 and P516 within the head region but only causes pigment dilution.  These data suggest that a segment of the head region including amino acids 659-693 may be critically important for the neuronal function of myosin Va. 

Primers

PCR Primer
naoki_pcr_F: AATGGTGGTCCCTTCAGCCTGTTC
naoki_pcr_R: AAGCCTTTAGTCCAAGAAGCTCTGC

Genotyping

Naoki genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Naoki(F): 5’- AATGGTGGTCCCTTCAGCCTGTTC -3’

Naoki(R): 5’- AAGCCTTTAGTCCAAGAAGCTCTGC -3’

Sequencing Primer

Naoki_seq(F): 5’- TTATGAACCACTCCCCTGTGAAG -3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 725 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5a) is amplified:

   1 aatggtggtc ccttcagcct gttctctgct cattgtttat ataatactaa gaaatctaca

 61 gcttttttta gtattgtgta gtaagggttc ataccttaat aattaaatgg ccctagcaac

121 aaaattgtaa gtcacatata atggaacttg caacaagaag caacagagaa aggagtacat

181 acatactcag caggataaac gtgtgggttt aggcaaatgt aaatgacacc cctagaattc

241 ttgtttatga accactcccc tgtgaagata actttaaatt tatgtcatct tcaatatgtt

301 aaaggagaat tttaaattgt ctttgatctc taacaaaact aattttttta acccttttca

361 tgcagtttcg aaactccctt cacctgctta tggaaaccct taatgccact actcctcact

421 atgtacgctg tattaagcct aatgatttca agtttccatt cacgtaagtc aaagtgaaat

481 aaggagaaag acttttgggg aagatcttca tgtcttgtag agggaatcta tttccaaaaa

541 tttctagttt tttgacaaca agaaaacaaa ttagcagttg gctttctaag gatttgaaaa

601 tttgaggcca atggcatgtc tttggttctg gttttctgtt ttgactccat ctctgttgga

661 gatctttctg gccttttgtt aatttggaca tcagttaaaa gcagagcttc ttggactaaa

721 ggctt

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References

  1. Searle, A. G. (1952) A Lethal Allele of Dilute in the House Mouse. Heredity. 6, 395-401.

  2. Russell, L. B. (1971) Definition of Functional Units in a Small Chromosomal Segment of the Mouse and its use in Interpreting the Nature of Radiation-Induced Mutations. Mutat Res. 11, 107-123.

  3. Moore, K. J., Seperack, P. K., Strobel, M. C., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1988) Dilute Suppressor Dsu Acts Semidominantly to Suppress the Coat Color Phenotype of a Deletion Mutation, dl20J, of the Murine Dilute Locus. Proc Natl Acad Sci U S A. 85, 8131-8135.

  4. Strobel, M. C., Seperack, P. K., Copeland, N. G., and Jenkins, N. A. (1990) Molecular Analysis of Two Mouse Dilute Locus Deletion Mutations: Spontaneous Dilute lethal20J and Radiation-Induced Dilute Prenatal Lethal Aa2 Alleles. Mol Cell Biol. 10, 501-509.

  5. Huang, J. D., Cope, M. J., Mermall, V., Strobel, M. C., Kendrick-Jones, J., Russell, L. B., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1998) Molecular Genetic Dissection of Mouse Unconventional Myosin-VA: Head Region Mutations. Genetics. 148, 1951-1961.

  6. Huang, J. D., Mermall, V., Strobel, M. C., Russell, L. B., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1998) Molecular Genetic Dissection of Mouse Unconventional Myosin-VA: Tail Region Mutations. Genetics. 148, 1963-1972.