Phenotypic Mutation 'chi' (pdf version)
Allele | chi |
Mutation Type |
missense
|
Chromosome | 4 |
Coordinate | 80,759,015 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Tyrp1
|
Gene Name | tyrosinase-related protein 1 |
Synonym(s) | Oca3, isa, TRP-1, Tyrp, TRP1 |
Chromosomal Location |
80,752,360-80,769,956 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009] PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
|
Accession Number | Ncbi RefSeq: NM_031202.2; MGI:98881
|
Mapped | Yes |
Amino Acid Change |
Tyrosine changed to Cysteine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000006151]
[ENSMUSP00000099895]
[ENSMUSP00000117080]
|
AlphaFold |
P07147 |
SMART Domains |
Protein: ENSMUSP00000006151 Gene: ENSMUSG00000005994 AA Change: Y296C
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
24 |
N/A |
INTRINSIC |
Pfam:Tyrosinase
|
182 |
417 |
1.7e-37 |
PFAM |
transmembrane domain
|
479 |
501 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000006151)
|
SMART Domains |
Protein: ENSMUSP00000099895 Gene: ENSMUSG00000005994 AA Change: Y296C
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
24 |
N/A |
INTRINSIC |
Pfam:Tyrosinase
|
182 |
417 |
4.9e-38 |
PFAM |
transmembrane domain
|
479 |
501 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000102831)
|
SMART Domains |
Protein: ENSMUSP00000117080 Gene: ENSMUSG00000005994
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
24 |
N/A |
INTRINSIC |
Pfam:Tyrosinase
|
182 |
229 |
1.1e-7 |
PFAM |
|
Predicted Effect |
probably benign
|
Meta Mutation Damage Score |
0.9445 |
Is this an essential gene? |
Probably nonessential (E-score: 0.182) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All alleles(59) : Targeted(1) Spontaneous(8) Chemically induced(22) Radiation induced(29)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01508:Tyrp1
|
APN |
4 |
80759002 |
missense |
possibly damaging |
0.95 |
IGL01586:Tyrp1
|
APN |
4 |
80763135 |
missense |
probably benign |
0.00 |
IGL01620:Tyrp1
|
APN |
4 |
80763039 |
nonsense |
probably null |
|
IGL02126:Tyrp1
|
APN |
4 |
80755845 |
nonsense |
probably null |
|
IGL02174:Tyrp1
|
APN |
4 |
80763063 |
nonsense |
probably null |
|
IGL02601:Tyrp1
|
APN |
4 |
80759012 |
missense |
probably null |
0.00 |
IGL02630:Tyrp1
|
APN |
4 |
80758994 |
missense |
possibly damaging |
0.95 |
Browncoat
|
UTSW |
4 |
80753399 |
missense |
probably damaging |
1.00 |
butter
|
UTSW |
4 |
80759043 |
critical splice donor site |
probably null |
|
ca-los
|
UTSW |
4 |
80763105 |
nonsense |
probably null |
|
R0011:Tyrp1
|
UTSW |
4 |
80759030 |
missense |
probably damaging |
1.00 |
R0011:Tyrp1
|
UTSW |
4 |
80759030 |
missense |
probably damaging |
1.00 |
R0145:Tyrp1
|
UTSW |
4 |
80759015 |
missense |
probably damaging |
1.00 |
R1172:Tyrp1
|
UTSW |
4 |
80763105 |
nonsense |
probably null |
|
R1173:Tyrp1
|
UTSW |
4 |
80763105 |
nonsense |
probably null |
|
R1175:Tyrp1
|
UTSW |
4 |
80763105 |
nonsense |
probably null |
|
R1886:Tyrp1
|
UTSW |
4 |
80759043 |
critical splice donor site |
probably null |
|
R2099:Tyrp1
|
UTSW |
4 |
80753616 |
missense |
possibly damaging |
0.69 |
R2273:Tyrp1
|
UTSW |
4 |
80755771 |
missense |
probably damaging |
0.99 |
R2274:Tyrp1
|
UTSW |
4 |
80755771 |
missense |
probably damaging |
0.99 |
R2275:Tyrp1
|
UTSW |
4 |
80755771 |
missense |
probably damaging |
0.99 |
R2312:Tyrp1
|
UTSW |
4 |
80755801 |
nonsense |
probably null |
|
R2427:Tyrp1
|
UTSW |
4 |
80769108 |
missense |
probably benign |
0.00 |
R2440:Tyrp1
|
UTSW |
4 |
80764843 |
missense |
probably benign |
0.41 |
R2915:Tyrp1
|
UTSW |
4 |
80755692 |
missense |
possibly damaging |
0.46 |
R4343:Tyrp1
|
UTSW |
4 |
80768078 |
missense |
possibly damaging |
0.92 |
R4512:Tyrp1
|
UTSW |
4 |
80755749 |
missense |
probably damaging |
1.00 |
R4703:Tyrp1
|
UTSW |
4 |
80759043 |
critical splice donor site |
probably null |
|
R4732:Tyrp1
|
UTSW |
4 |
80763172 |
missense |
possibly damaging |
0.67 |
R4733:Tyrp1
|
UTSW |
4 |
80763172 |
missense |
possibly damaging |
0.67 |
R4788:Tyrp1
|
UTSW |
4 |
80763180 |
nonsense |
probably null |
|
R4834:Tyrp1
|
UTSW |
4 |
80764833 |
nonsense |
probably null |
|
R4911:Tyrp1
|
UTSW |
4 |
80769144 |
utr 3 prime |
probably benign |
|
R4938:Tyrp1
|
UTSW |
4 |
80758883 |
missense |
probably damaging |
1.00 |
R5129:Tyrp1
|
UTSW |
4 |
80764844 |
missense |
probably damaging |
1.00 |
R5154:Tyrp1
|
UTSW |
4 |
80768954 |
missense |
probably benign |
0.00 |
R6249:Tyrp1
|
UTSW |
4 |
80769009 |
missense |
possibly damaging |
0.93 |
R6492:Tyrp1
|
UTSW |
4 |
80759018 |
missense |
probably null |
1.00 |
R6617:Tyrp1
|
UTSW |
4 |
80764984 |
missense |
probably benign |
0.24 |
R6870:Tyrp1
|
UTSW |
4 |
80769014 |
missense |
probably benign |
0.37 |
R6990:Tyrp1
|
UTSW |
4 |
80753674 |
missense |
probably damaging |
1.00 |
R7275:Tyrp1
|
UTSW |
4 |
80755821 |
missense |
possibly damaging |
0.78 |
R7684:Tyrp1
|
UTSW |
4 |
80758862 |
missense |
probably damaging |
1.00 |
R7980:Tyrp1
|
UTSW |
4 |
80758864 |
missense |
probably damaging |
1.00 |
R8001:Tyrp1
|
UTSW |
4 |
80758907 |
missense |
probably benign |
0.10 |
R8051:Tyrp1
|
UTSW |
4 |
80755897 |
missense |
probably damaging |
1.00 |
R8233:Tyrp1
|
UTSW |
4 |
80769190 |
missense |
unknown |
|
R8326:Tyrp1
|
UTSW |
4 |
80768921 |
missense |
probably benign |
0.06 |
R8831:Tyrp1
|
UTSW |
4 |
80753399 |
missense |
probably damaging |
1.00 |
R8907:Tyrp1
|
UTSW |
4 |
80755798 |
missense |
probably damaging |
1.00 |
R8998:Tyrp1
|
UTSW |
4 |
80763094 |
missense |
probably damaging |
1.00 |
R8999:Tyrp1
|
UTSW |
4 |
80763094 |
missense |
probably damaging |
1.00 |
R9732:Tyrp1
|
UTSW |
4 |
80758930 |
missense |
possibly damaging |
0.52 |
R9751:Tyrp1
|
UTSW |
4 |
80759012 |
missense |
probably null |
0.00 |
Z1176:Tyrp1
|
UTSW |
4 |
80763126 |
nonsense |
probably null |
|
Z1177:Tyrp1
|
UTSW |
4 |
80768054 |
missense |
probably benign |
|
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | Live Mice |
MMRRC Submission |
037047-MU
|
Last Updated |
2019-04-23 7:45 PM
by Diantha La Vine
|
Record Created |
2013-05-01 8:28 AM
by Adam Dismang
|
Record Posted |
2013-10-28 |
Phenotypic Description |
The chi mutation was induced by ENU mutagenesis on the C57BL/6J (black) background and was discovered in G3 animals. The mutant mice exhibit a brown coat color and black eyes (Figure 1).
|
Nature of Mutation | Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. Among these, only one affected a gene with known effects on pigmentation, Tyrp1. The mutation in Tyrp1 was presumed to be causative because the chi hypopigmentation phenotype mimics other known alleles of Tyrp1 (see MGI for a list of Tyrp1 alleles). The Tyrp1 mutation was identified as an A to G transition at base pair 80840778 (v38) on chromosome 4 in the GenBank genomic region NC_000070 encoding Tyrp1. The mutation corresponds to residue 1159 in the mRNA sequence (NM_031202.2) in exon 4 of 8 total exons.
1141 GTGAATCCTTGGAAGAGTACGATACCCTGGGAACACTT
290 C--E--S--L--E--E--Y--D--T--L--G--T--L-
|
The mutated nucleotide is indicated in red. The mutation results in a conversion of tyrosine (Y) to cysteine (C) at residue 296 of the tyrosinase-related protein 1 (Tyrp1).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
The tyrosinase-related protein (TRP) family consists of Tyrp1 (Trp1, gp75), tyrosinase (Tyr; see the records for ghost, pale rider, and siamese), and Tyrp2 [alternatively, DOPAchrome tautomerase (DCT)]. Tyrp1 shares ~40-52% amino acid sequence homology with Tyr [reviewed in (1;2)]. The TRP proteins share homologous domains including two copper binding regions, an EGF-like/cysteine (Cys)-rich domain, a central cysteine-rich region, a transmembrane domain, a signal sequence and six putative glycosylation sites [Figure 2; (3-7); reviewed in (1;2;8;9)]:
-
The N-terminal 24 amino acid signal peptide of Tyrp1 is essential for the correct processing of Tyrp1 [reviewed in (1)].
-
The two copper-binding regions (CuA and CuB) are highly conserved among the three TRP family members (7). Each domain contains three histidine residues that are required for copper binding [(7); reviewed in (1)]. Studies have shown that, in Tyr, copper binding is essential for catalytic activity (10), however, the extent of copper binding to Tyrp1 is minimal (7).
-
Seventeen cysteine residues present in Tyrp1 are clustered into two Cys-rich regions. The N-terminal Cys-rich region is also an EGF-like domain; the central Cys-rich region is within the catalytic domain between the two-copper-binding regions. The EGF-like/Cys-rich domain is proposed to play a role in protein-protein interactions [(11); reviewed in (1;9)]. Tyr and Tyrp1 form heterodimers, possibly through the EGF-like motif (4;12-14). Tyr, Tyrp1, and Tyrp2 form a multi-enzyme complex within the ER and Golgi as well as in the early and late melanosomes (4;13;15-17). PKC-β-mediated phosphorylation of Tyr may promote complex formation between Tyrp1 and Tyr (17). Both Tyrp1 and Tyrp2 help to stabilize Tyr within the complex (4;12;14). Consistent with this, the brown mutation of Tyrp1, C86Y located in the N-terminal EGF-like domain, leads to decreased stability of Tyr in melanocytes (4;18;19), thereby affecting Tyr activity. Studies have reported that Tyrp1 can either increase (4;14;20) or decrease (16) Tyr activity. Kobayashi et al. found that in mouse melanocytes, Tyrp1 expression increased Tyr stability and melanogenesis (i.e., melanin synthesis) (4). However, Orlow et al. determined that dissociation of the Tyrp1-Tyr complex resulted in an increase in Tyr activity, suggesting that Tyrp1 inhibits Tyr activity (16). Wu et al. propose that the changes in Tyrp1-Tyr association observed by Orlow et al. could be due the use of a detergent treatment when assaying for Tyr activity (17).
-
Disulfide bonds (and other non-covalent interactions sensitive to thermal denaturation) stabilize Tyrp1 [(11); reviewed in (1)]. Although the cysteine residues that participate in disulfide bonds are unknown, proper disulfide bond pattern and protein conformation are essential for Tyrp1 trafficking from the ER (11). Treatment of Tyrp1-expressing mouse B16 melanoma cells with dithiothreitol (DTT) resulted in prolonged interaction of Tyrp1 with ER chaperones (e.g., calnexin and BiP) and subsequent targeting of Tyrp1 for degradation (11).
-
The transmembrane domain of Tyrp1 (amino acids 479-501) functions in proper trafficking to the melanosome and incorporation into the melanosome-limiting membrane (12;21).
-
Tyrp1 has six potential N-linked glycosylation sites (i.e., Asn-X-Ser/Thr; X is any amino acid) at the luminal domain: Asn96, 104, 181, 304, 350, and 385 (22). However, Xu et al. determined that, in mouse, there are only five residues that are N-glycosylated: Asn96, 181, 304, 350, and 385; Asn104 is not glycosylated (22). N-linked glycosylation at Asn181, 304, and 385 influences intracellular transport of Tyrp1, while N-glycosylation at Asn350 influences the stability of Tyrp1 in the endocytic pathway (22). Inhibition of the early steps of N-glycosylation by N-butlydeoxynojirimicin (NB-DNJ; inhibitor of α-glucosidase I) resulted in only a slight reduction of Tyrp1 DOPA oxidase activity, while the same treatment caused Tyr to be synthesized as an inactive form [(5); for more information about Tyrp1 and DOPA oxidase activity see “Background”, below]. Furthermore, changes in Tyrp1 glycan processing did not result in changes to Tyrp1 conformation near the active site (5).
-
The C-terminal 36 amino acids (amino acids 501-537), along with the transmembrane domain, are required for intracellular retention and sorting of Tyrp1 (21). Deletion of 27-33 of the amino acids of the cytoplasmic tail resulted in targeting of Tyrp1 to the cell surface instead of to the endosome/lysosome (23). In fibroblast transfectants, residues 511-517 (NQPLLTD) were necessary for sorting Tyrp1 in the endocytic pathway (21). The QPLLTD sequence containing the “di-leucine motif” is conserved among melanosomal membrane proteins (21). The C-terminal tail of Tyrp1 interacts with GIPC/SEMCAP-1, a PDZ domain-containing protein, within and near the Golgi (24). The interaction of Tyrp1 with GIPC is proposed to function during intracellular sorting and targeting of Tyrp1 to the melanosome (24).
Studies have determined that mature Tyrp1 can exist both as an intracellular form (75-80 kDa) and a secreted form (78-88 kDa) [(25); reviewed in (1;8)]. Intracellular Tyrp1 has the N-terminal signal peptide, a long N-terminal luminal domain with the N-linked glycosylation sites, a transmembrane region, and the C-terminal domain (25). In contrast, soluble Tyrp1 lacks the transmembrane domain, the C-terminal tail, and a small region in the luminal domain (25). The chi mutation resides within the catalytic domain of Tyrp1, a domain that contains the copper-binding motifs and one of the EGF-like domains. A mutation within the catalytic domain could alter the association of Tyrp1 to Tyr and/or the DHICA oxidase function of Tyrp1. TGF-β1 inhibits the activity of Tyrp1
Transforming growth factor (TGF)-β1 is a multifunctional cytokine that regulates several processes, including proliferation, differentiation, adhesion, and migration, in many cell types [reviewed in (26;27)]. TGF-β1 negatively regulates the activities of both Tyrp1 and Tyr in mouse melanoma cells by reducing their abundance; Tyrp2 activity is not changed (28). Martinez-Esparza et al. propose that the TGF-β1-mediated changes to the Tyrp1 protein level are due to post-translational events (28). Other factors that regulate the expression of Tyrp1 are described in "Expression/Localization", below.
|
Expression/Localization | Tyrp1 is localized in melanosomes of the skin, hair follicle, inner ear, choroid, iris, and ciliary body as well as in the retinal pigment epithelium (RPE) [reviewed in (29)]. For more information on the localization of Tyrp1, please see “Transport of Typr1 in the melanosome” in the Background section, below. The first exon of Tyrp1 is noncoding and, along with the first intron, is required for efficient gene expression, but not for pigment cell specificity [(30); reviewed in (1;29)]. The TRP proteins can be regulated by several stimuli including vitamins, interleukins (31), prostaglandins (32), sex steroids (33), interferons (34), ultraviolet light (35), and melanocyte stimulating hormone (36). The TRP proteins all contain an M-box motif (AGTCATGTGCT) upstream of the TATA box (between positions -44 and -34) in their respective promoters that can bind to microphthalmia transcription factor (MITF), a basic helix-loop-helix transcription factor [(37-41); reviewed in (8;9;29)]. Binding of MITF to the Tyrp1 promoter increased Tyrp1 promoter activity (37). cAMP (cyclic AMP) facilitates the upregulation of MITF and the subsequent association of MITF with Tyrp1 (37). cAMP-elevating agents stimulated the transcriptional activity of the Tyrp1 promoter, subsequently leading to an increase in Tyrp1 mRNA; the protein levels were also increased (37). Bertolotto et al. determined that the cAMP-elevating agents stimulated the transcription of Tyrp1 via the cAMP-dependent protein kinase (PKA) pathway (37). T-box factor Tbx2 by binds to two elements, MSEu and MSEi, to negatively regulate Tyrp1 expression (42;43). The MSE elements are comprised of a six nucleotide sequence, GTGTGA. Pax3, a member of the paired box (PAX) family of transcription factors, also binds the Tyrp1 promoter at the MSE elements, subsequently upregulating Tyrp1 activity in melanocytes (40). Promoter analysis determined that Tyrp1 expression is regulated by different factors in melanocytes of the skin, hair follicle, inner ear, choroid, iris, and ciliary body versus the RPE (41). For example, the homeobox factor, Otx2, controls RPE-specific expression of Tyrp1 (44). Murisier et al. identified a highly conserved region at -15 kb that acts as a melanocyte-specific enhancer of Tyrp1 expression; the transcription factor Sox10 binds and transactivates this enhancer (41).
|
Background |
The production of melanin in the skin, hair follicle, inner ear, choroid, iris, ciliary body, and RPE results in pigmentation [reviewed in (29)]. Tyr, Tyrp1, and Tyrp2 are Cu++/Zn++ metalloenzymes that function in melanogenesis leading to the formation of two types of pigments, eumelanins (brown or black) and pheomelanins (yellow or red) [Figure 3; reviewed in (4;8;13;45)]. The pigments are synthesized in melanosomes, which arise from the endosomal or secretory pathway and progress through four stages of maturation (I-IV), as defined by their electron microscopic appearance (46). Melanin synthesis begins with the chemical conversion of tyrosine to dopaquinone, a reaction catalyzed by Tyr. Both eumelanin and pheomelanin derive from dopaquinone, thus Tyr determines the rate and total amount of melanin production. Pheomelanin production proceeds spontaneously following dopaquinone production, while eumelanin production further requires Tyrp1 and Tyrp2 [reviewed in (46;47)]. Tyrp2 catalyzes the non-decarboxylative rearrangement of L-dopachrome to 5,6-dihydroxyindole-2-carboxylic acid (DHICA); the function of Tyrp1 is described below (48). For more information about melanogenesis, please see the record for ghost. Several enzymatic activities have been attributed to murine Tyrp1: tyrosine hydroxylase and DOPA oxidase activities (49-51), DOPAchrome tautomerase function (along with Tyrp2) (52), DHICA oxidase activity (53;54), and catalase activity (hydrogen-peroxide:hydrogen-peroxide oxidoreduction) (55). The primary function attributed to Tyrp1 is that of a DHICA oxidase (53;54), catalyzing the oxidation of DHICA to indole-5,6-quinone-2-carboxylic acid, a product eventually converted to eumelanin (54). The role of TYRP1 in human melanocytes, in contrast, is currently unclear (17). For example, Boissy et al. found that human TYRP1 did not have DHICA oxidase activity (56). In addition, Zhao et al. determined that human TYRP1 did not exhibit DOPA oxidase activity; TYRP1 exhibited tyrosine hydrolase activity in this study (51). Transport of Tyrp1 in the melanosome
Tyrp1 is synthesized in the ER, transported to the Golgi where it undergoes post-translational processing, then from the trans-Golgi network (TGN) to an endosomal compartment [Figure 4; (57-60)]. Early endosomes are requisite intermediates in the trafficking of Tyrp1 from the Golgi to the late stage melanosomes (61). Within the endosomal intermediate, Tyrp1 is sorted away from both late endocytic and pre-melanosomal cargoes (61). Tyrp1 associates with several proteins that are essential for proper trafficking of Tyrp1 to melanosomes including Rab7, Rab38, Rab32, ESCRT-I, Varp (VPS9-ankyrin-repeat protein), syntaxin-3, PI3-kinase, BLOC (biogenesis of lysosome-related organelles complex)-1, BLOC-2, and AP-1 [Table 1; (58;59;62-65)]. Whereas the dileucine motif of tyrosinase interacts with the adaptor complex AP-3 (see the record for bullet gray), studies have shown that AP-3 does not interact with Tyrp1 (66-68). In AP-3 deficient melanocytes, tyrosinase is mislocalized, but Tyrp1 is properly targeted (66;67). Table 1. Essential proteins for Tyrp1 trafficking
Protein
|
Known function
|
Tyrp1-associated function
|
References
|
SLC45A2 (alternatively, MATP)
|
Transporter protein (see the record for cardigan)
|
Processing and trafficking of Tyrp1 from the trans-Golgi network (TGN)
|
(60)
|
Rab7
|
Mannose-6-phosphate receptor
|
Transport of Tyrp1 from the TGN to the endosome-lysosomal system and maturing melanosomes
|
(58;59;69)
|
Rab38 & Rab32
|
GTPases (see the record for fenrir for information about Rab38)
|
Transport of Tyrp1 from the TGN to the melanosomes
|
(63;70)
|
Phosphatidylinositide (PI) 3-kinase
|
Various functions, including regulation of protein trafficking
|
Trafficking of Tyrp1 from the late endosome to the melanosome; wortmannin (a PI 3-kinase inhibitor) blocks Rab7-stimulated transport
|
(57;71)
|
ESCRT-I
|
Component of the endosomal sorting complex machinery
|
Transport of Tyrp1 from the TGN to the melanosomes
|
(61)
|
Varp
|
Rab32/38 binding protein and guanine nucleotide exchange factor for Rab21. Varp interacts with the vesicle SNARE VAMP7.
|
Facilitates, along with Rab32/38, trafficking of Tyrp1 (e.g., transport from an endoplasmic reticulum [ER] to the Golgi, transport from endosomes or the trans-Golgi network, tethering, docking, and/or fusion of Tyrp1-containing vesicles to melanosomes)
|
(63;64)
|
Syntaxin-3
|
Target (t)-SNARE in intracellular vesicle trafficking
|
Trafficking to peripheral melanosomes. Syntaxin-3 and SNAP23 on melanosomes interact with VAMP7 on Tyrp1-containing vesicles to regulate Tyrp1 trafficking.
|
(62)
|
BLOC-1
|
Protein complex that regulates intracellular trafficking (see the records for salt and pepper and minnie for information about members of the BLOC-1 complex)
|
Promotes the transit of Tyrp1 from endosomes to melanosomes. Lack of a subunit of BLOC-1 resulted in mislocalization of Tyrp1 to early endosomes and at the cell surface.
|
(65;72)
|
BLOC-2
|
Protein complex that regulates intracellular trafficking (see the record for pam gray, toffee, and stamper-coat for information about the members of the BLOC-2 complex)
|
Promotes the transit of Tyrp1 from endosomes to melanosomes. Tyrp1 expression is reduced in BLOC-2-deficient melancotyes.
|
(65;72;73)
|
AP-1
|
Clathrin adaptor complex that sorts proteins in the TGN (see the record for bullet gray for information about AP-3)
|
Tyrp1 sorting
|
(66;74;75)
|
TYRP1 mutations cause hypopigmentation
Mutations in TYRP1 are linked to oculocuaneous albinism type III [OCA3; OMIM: # 203290; (76;77)] and variations in skin/hair/eye pigmentation linked to 9p23 in Melanesians [OMIM: # 612271; (78)]. Individuals with OCA3 have reduced pigment of the skin, hair, and eyes (76). Melanocytes isolated from a patient with OCA3 did not express TYRP1, subsequently resulting in reduced melanin production; TYR transcription and translation were normal (76). Tyrp1 mutations have also been linked to pigmentation changes in domestic cats (79;80), dogs (81;82), cattle (83), horses (84), and mice (see “Putative Mechanism”, below). Additional functions of Tyrp1
In addition to its role in melanogenesis, Tyrp1 also promotes melanocyte viability/survival (15;85-87), protects melanocytes against oxidative stress (88), and is a melanocyte differentiation marker (8;89). Tyrp1 functions to protect melanocytes from the cytotoxicity of melanin intermediates produced by Tyr; Tyrp1 does not protect against Tyr-mediated cell death in nonmelanocytic cells (15;90). Through the formation of the Tyr-Tyrp1-Tyrp2 complex in melanocytes, the leakage of toxic melanin intermediates is decreased [see “Protein Prediction”, above, for information about the Tyr-Tyrp1-Tyrp2 complex] (12;14;16). Luo et al. propose that Tyrp1 participates in scavenging cytotoxic melanin intermediates via an interaction with Lamp1 (87). Loss of TYRP1 expression in cutaneous neoplastic melanocytes is linked to the appearance of transformed melanocytes in the underlying dermis (39;91). TYRP1 mRNA and protein expression are reduced in several melanoma cell lines and specimens due to decreased expression of MITF (39;91-93). In TYRP1-melanoma cells, binding of MITF to the TYRP1 M box is inhibited due to activation of factors that interfere with binding (39). Gene profiling in skin and lymph nodes (i.e., the most frequent sites of melanoma metastases) revealed an inverse correlation between the level of TYRP1 expression and patient survival (94).
|
Putative Mechanism | To-date 58 mouse Tyrp1 mutant alleles have been documented (MGI). Homozygous Tyrp1 mutants [e.g., brown, MGI:1855960; cordovan, MGI: 1855961; light, MGI:1855962; white-based brown, MGI: 1855963] exhibit a brown coat color on a non-agouti background [reviewed in (29)]. The brown mutation (Cys86Tyr) is within the EGF-like/Cys-rich domain and results in a mutant protein that is mislocalized and does not get delivered to melanosomes (95;96). Kobayashi et al. propose that the mutant protein is unable to associate with Tyr, subsequently leading to decreased stabilization of Tyr and degradation of Tyr (4;13). Melanosomes from brown homozygotes are round, particulate, and disorganized compared to the lamellar and regular structures observed in normal animals (4). The light mutation (Arg38Cys) results in premature death of follicular melanocytes due to pigment production-induced cytotoxicity (90). The light mouse has lightly (or non) pigmented hair at the tip; pigmentation is absent at the base of the hair. This phenotype persists for each hair cycle, but the light base progresses with age; older mice can have almost completely pale gray fur (90). Tyrp1 mRNA expression is normal in this model. Similar to the light mouse, the white-based brown mouse exhibits absence (or reduction) in pigment at the base of the hair (90;97). The white-based brown mutation is an insertion of DNA or a chromosomal translocation at the 3’ end of the first intron of Tyrp1; Tyrp1 transcripts are not produced (97). The white-based brown mutation leads to premature melanocyte death, similar to the light mutant. The chi mutation also results in hypopigmentation. It is unknown whether the chi mutation results in the death of follicular melanocytes. Tyrp1 expression and Tyrp1 localization have not been examined.
|
Primers |
PCR Primer
chi_pcr_F: ACACACTCACTGACTCCTTAGCAGG
chi_pcr_R: GGTGCTTAACGTGCAACTGCATTG
|
Genotyping | Chi genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
PCR Primers
Chi(F): 5’- ACACACTCACTGACTCCTTAGCAGG -3’
Chi(R): 5’- GGTGCTTAACGTGCAACTGCATTG -3’ Sequencing Primer
Chi_seq(F): 5’- TCACTGACTCCTTAGCAGGTAGAG -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40X
6) 72°C 10:00
7) 4°C ∞ The following sequence of 456 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Tyrp1) is amplified: 1 acacactcac tgactcctta gcaggtagag agctaaagga aaaggacacc agggctaagc
61 aagccaggac acaagatgtt agcagaagca gagaccacta atggatttct atgatctagg
121 agatgctgca ggagccttct ttctcccttc cttactggaa ttttgcaact gggaaaaacg
181 tctgcgatgt ctgcactgat gacttgatgg gatccagaag caacttcgat tctactctta
241 taagccccaa ctctgtcttt tctcaatgga gagtggtctg tgaatccttg gaagagtacg
301 ataccctggg aacactttgt aacagtaaga cccaaatgac agctactatt cacaattctt
361 tattctataa atgactgtgt tgcctgtaag gtccctcttc agagtgaaat ctgctatctc
421 tcttcagaga atcaatgcag ttgcacgtta agcacc Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.
|
References |
5. Negroiu, G., Branza-Nichita, N., Petrescu, A. J., Dwek, R. A., and Petrescu, S. M. (1999) Protein Specific N-Glycosylation of Tyrosinase and Tyrosinase-Related Protein-1 in B16 Mouse Melanoma Cells. Biochem J. 344 Pt 3, 659-665.
7. Furumura, M., Solano, F., Matsunaga, N., Sakai, C., Spritz, R. A., and Hearing, V. J. (1998) Metal Ligand-Binding Specificities of the Tyrosinase-Related Proteins. Biochem Biophys Res Commun. 242, 579-585.
12. Jimenez-Cervantes, C., Martinez-Esparza, M., Solano, F., Lozano, J. A., and Garcia-Borron, J. C. (1998) Molecular Interactions within the Melanogenic Complex: Formation of Heterodimers of Tyrosinase and TRP1 from B16 Mouse Melanoma. Biochem Biophys Res Commun. 253, 761-767.
14. Winder, A., Kobayashi, T., Tsukamoto, K., Urabe, K., Aroca, P., Kameyama, K., and Hearing, V. J. (1994) The Tyrosinase Gene Family--Interactions of Melanogenic Proteins to Regulate Melanogenesis. Cell Mol Biol Res. 40, 613-626.
15. Rad, H. H., Yamashita, T., Jin, H. Y., Hirosaki, K., Wakamatsu, K., Ito, S., and Jimbow, K. (2004) Tyrosinase-Related Proteins Suppress Tyrosinase-Mediated Cell Death of Melanocytes and Melanoma Cells. Exp Cell Res. 298, 317-328.
16. Orlow, S. J., Zhou, B. K., Chakraborty, A. K., Drucker, M., Pifko-Hirst, S., and Pawelek, J. M. (1994) High-Molecular-Weight Forms of Tyrosinase and the Tyrosinase-Related Proteins: Evidence for a Melanogenic Complex. J Invest Dermatol. 103, 196-201.
19. Shibahara, S., Okinaga, S., Tomita, Y., Takeda, A., Yamamoto, H., Sato, M., and Takeuchi, T. (1990) A Point Mutation in the Tyrosinase Gene of BALB/c Albino Mouse Causing the Cysteine----Serine Substitution at Position 85. European Journal of Biochemistry. 189, 455-461.
20. Manga, P., Sato, K., Ye, L., Beermann, F., Lamoreux, M. L., and Orlow, S. J. (2000) Mutational Analysis of the Modulation of Tyrosinase by Tyrosinase-Related Proteins 1 and 2 in Vitro. Pigment Cell Res. 13, 364-374.
22. Xu, Y., Bartido, S., Setaluri, V., Qin, J., Yang, G., and Houghton, A. N. (2001) Diverse Roles of Conserved Asparagine-Linked Glycan Sites on Tyrosinase Family Glycoproteins. Exp Cell Res. 267, 115-125.
28. Martinez-Esparza, M., Jimenez-Cervantes, C., Beermann, F., Aparicio, P., Lozano, J. A., and Garcia-Borron, J. C. (1997) Transforming Growth Factor-beta1 Inhibits Basal Melanogenesis in B16/F10 Mouse Melanoma Cells by Increasing the Rate of Degradation of Tyrosinase and Tyrosinase-Related Protein-1. J Biol Chem. 272, 3967-3972.
30. Shibata, K., Takeda, K., Tomita, Y., Tagami, H., and Shibahara, S. (1992) Downstream Region of the Human Tyrosinase-Related Protein Gene Enhances its Promoter Activity. Biochem Biophys Res Commun. 184, 568-575.
33. Kippenberger, S., Loitsch, S., Solano, F., Bernd, A., and Kaufmann, R. (1998) Quantification of Tyrosinase, TRP-1, and Trp-2 Transcripts in Human Melanocytes by Reverse Transcriptase-Competitive Multiplex PCR--Regulation by Steroid Hormones. J Invest Dermatol. 110, 364-367.
37. Bertolotto, C., Busca, R., Abbe, P., Bille, K., Aberdam, E., Ortonne, J. P., and Ballotti, R. (1998) Different Cis-Acting Elements are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia. Mol Cell Biol. 18, 694-702.
42. Carreira, S., Dexter, T. J., Yavuzer, U., Easty, D. J., and Goding, C. R. (1998) Brachyury-Related Transcription Factor Tbx2 and Repression of the Melanocyte-Specific TRP-1 Promoter. Mol Cell Biol. 18, 5099-5108.
44. Martinez-Morales, J. R., Dolez, V., Rodrigo, I., Zaccarini, R., Leconte, L., Bovolenta, P., and Saule, S. (2003) OTX2 Activates the Molecular Network Underlying Retina Pigment Epithelium Differentiation. J Biol Chem. 278, 21721-21731.
47. Jimbow, K., Hua, C., Gomez, P. F., Hirosaki, K., Shinoda, K., Salopek, T. G., Matsusaka, H., Jin, H. Y., and Yamashita, T. (2000) Intracellular Vesicular Trafficking of Tyrosinase Gene Family Protein in Eu- and Pheomelanosome Biogenesis. Pigment Cell Res. 13 Suppl 8, 110-117.
50. Jimenez-Cervantes, C., Garcia-Borron, J. C., Valverde, P., Solano, F., and Lozano, J. A. (1993) Tyrosinase Isoenzymes in Mammalian Melanocytes. 1. Biochemical Characterization of Two Melanosomal Tyrosinases from B16 Mouse Melanoma. Eur J Biochem. 217, 549-556.
53. Kobayashi, T., Urabe, K., Winder, A., Jimenez-Cervantes, C., Imokawa, G., Brewington, T., Solano, F., Garcia-Borron, J. C., and Hearing, V. J. (1994) Tyrosinase Related Protein 1 (TRP1) Functions as a DHICA Oxidase in Melanin Biosynthesis. EMBO J. 13, 5818-5825.
54. Jimenez-Cervantes, C., Solano, F., Kobayashi, T., Urabe, K., Hearing, V. J., Lozano, J. A., and Garcia-Borron, J. C. (1994) A New Enzymatic Function in the Melanogenic Pathway. the 5,6-Dihydroxyindole-2-Carboxylic Acid Oxidase Activity of Tyrosinase-Related Protein-1 (TRP1). J Biol Chem. 269, 17993-18000.
56. Boissy, R. E., Sakai, C., Zhao, H., Kobayashi, T., and Hearing, V. J. (1998) Human Tyrosinase Related Protein-1 (TRP-1) does Not Function as a DHICA Oxidase Activity in Contrast to Murine TRP-1. Exp Dermatol. 7, 198-204.
58. Gomez, P. F., Luo, D., Hirosaki, K., Shinoda, K., Yamashita, T., Suzuki, J., Otsu, K., Ishikawa, K., and Jimbow, K. (2001) Identification of rab7 as a Melanosome-Associated Protein Involved in the Intracellular Transport of Tyrosinase-Related Protein 1. J Invest Dermatol. 117, 81-90.
59. Hida, T., Sohma, H., Kokai, Y., Kawakami, A., Hirosaki, K., Okura, M., Tosa, N., Yamashita, T., and Jimbow, K. (2011) Rab7 is a Critical Mediator in Vesicular Transport of Tyrosinase-Related Protein 1 in Melanocytes. J Dermatol. 38, 432-441.
60. Costin, G. E., Valencia, J. C., Vieira, W. D., Lamoreux, M. L., and Hearing, V. J. (2003) Tyrosinase Processing and Intracellular Trafficking is Disrupted in Mouse Primary Melanocytes Carrying the Underwhite (Uw) Mutation. A Model for Oculocutaneous Albinism (OCA) Type 4. J Cell Sci. 116, 3203-3212.
61. Truschel, S. T., Simoes, S., Setty, S. R., Harper, D. C., Tenza, D., Thomas, P. C., Herman, K. E., Sackett, S. D., Cowan, D. C., Theos, A. C., Raposo, G., and Marks, M. S. (2009) ESCRT-I Function is Required for Tyrp1 Transport from Early Endosomes to the Melanosome Limiting Membrane. Traffic. 10, 1318-1336.
64. Tamura, K., Ohbayashi, N., Maruta, Y., Kanno, E., Itoh, T., and Fukuda, M. (2009) Varp is a Novel Rab32/38-Binding Protein that Regulates Tyrp1 Trafficking in Melanocytes. Mol Biol Cell. 20, 2900-2908.
65. Setty, S. R., Tenza, D., Truschel, S. T., Chou, E., Sviderskaya, E. V., Theos, A. C., Lamoreux, M. L., Di Pietro, S. M., Starcevic, M., Bennett, D. C., Dell'angelica, E. C., Raposo, G., and Marks, M. S. (2007) BLOC-1 is Required for Cargo-Specific Sorting from Vacuolar Early Endosomes Toward Lysosome-Related Organelles. Mol Biol Cell. 18, 768-780.
66. Huizing, M., Sarangarajan, R., Strovel, E., Zhao, Y., Gahl, W. A., and Boissy, R. E. (2001) AP-3 Mediates Tyrosinase but Not TRP-1 Trafficking in Human Melanocytes. Mol Biol Cell. 12, 2075-2085.
69. Hirosaki, K., Yamashita, T., Wada, I., Jin, H. Y., and Jimbow, K. (2002) Tyrosinase and Tyrosinase-Related Protein 1 Require Rab7 for their Intracellular Transport. J Invest Dermatol. 119, 475-480.
70. Wasmeier, C., Romao, M., Plowright, L., Bennett, D. C., Raposo, G., and Seabra, M. C. (2006) Rab38 and Rab32 Control Post-Golgi Trafficking of Melanogenic Enzymes. J Cell Biol. 175, 271-281.
72. Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 Interacts with BLOC-2 and the AP-3 Complex to Facilitate Protein Trafficking on Endosomes 2. Mol Biol Cell. 17, 4027-4038.
73. Helip-Wooley, A., Westbroek, W., Dorward, H. M., Koshoffer, A., Huizing, M., Boissy, R. E., and Gahl, W. A. (2007) Improper Trafficking of Melanocyte-Specific Proteins in Hermansky-Pudlak Syndrome Type-5. J Invest Dermatol. 127, 1471-1478.
74. Theos, A. C., Tenza, D., Martina, J. A., Hurbain, I., Peden, A. A., Sviderskaya, E. V., Stewart, A., Robinson, M. S., Bennett, D. C., Cutler, D. F., Bonifacino, J. S., Marks, M. S., and Raposo, G. (2005) Functions of Adaptor Protein (AP)-3 and AP-1 in Tyrosinase Sorting from Endosomes to Melanosomes. Mol Biol Cell. 16, 5356-5372.
75. Raposo, G., Tenza, D., Murphy, D. M., Berson, J. F., and Marks, M. S. (2001) Distinct Protein Sorting and Localization to Premelanosomes, Melanosomes, and Lysosomes in Pigmented Melanocytic Cells. J Cell Biol. 152, 809-824.
76. Boissy, R. E., Zhao, H., Oetting, W. S., Austin, L. M., Wildenberg, S. C., Boissy, Y. L., Zhao, Y., Sturm, R. A., Hearing, V. J., King, R. A., and Nordlund, J. J. (1996) Mutation in and Lack of Expression of Tyrosinase-Related Protein-1 (TRP-1) in Melanocytes from an Individual with Brown Oculocutaneous Albinism: A New Subtype of Albinism Classified as "OCA3". Am J Hum Genet. 58, 1145-1156.
77. Manga, P., Kromberg, J. G., Box, N. F., Sturm, R. A., Jenkins, T., and Ramsay, M. (1997) Rufous Oculocutaneous Albinism in Southern African Blacks is Caused by Mutations in the TYRP1 Gene. Am J Hum Genet. 61, 1095-1101.
78. Kenny, E. E., Timpson, N. J., Sikora, M., Yee, M. C., Moreno-Estrada, A., Eng, C., Huntsman, S., Burchard, E. G., Stoneking, M., Bustamante, C. D., and Myles, S. (2012) Melanesian Blond Hair is Caused by an Amino Acid Change in TYRP1. Science. 336, 554.
81. Cargill, E. J., Famula, T. R., Schnabel, R. D., Strain, G. M., and Murphy, K. E. (2005) The Color of a Dalmatian's Spots: Linkage Evidence to Support the TYRP1 Gene. BMC Vet Res. 1, 1.
83. Berryere, T. G., Schmutz, S. M., Schimpf, R. J., Cowan, C. M., and Potter, J. (2003) TYRP1 is Associated with Dun Coat Colour in Dexter Cattle Or how Now Brown Cow? Anim Genet. 34, 169-175.
84. Rieder, S., Taourit, S., Mariat, D., Langlois, B., and Guerin, G. (2001) Mutations in the Agouti (ASIP), the Extension (MC1R), and the Brown (TYRP1) Loci and their Association to Coat Color Phenotypes in Horses (Equus Caballus). Mamm Genome. 12, 450-455.
86. Sarangarajan, R., Zhao, Y., Babcock, G., Cornelius, J., Lamoreux, M. L., and Boissy, R. E. (2000) Mutant Alleles at the Brown Locus Encoding Tyrosinase-Related Protein-1 (TRP-1) Affect Proliferation of Mouse Melanocytes in Culture. Pigment Cell Res. 13, 337-344.
91. Fang, D., Hallman, J., Sangha, N., Kute, T. E., Hammarback, J. A., White, W. L., and Setaluri, V. (2001) Expression of Microtubule-Associated Protein 2 in Benign and Malignant Melanocytes: Implications for Differentiation and Progression of Cutaneous Melanoma. Am J Pathol. 158, 2107-2115.
92. Chen, Y. T., Stockert, E., Tsang, S., Coplan, K. A., and Old, L. J. (1995) Immunophenotyping of Melanomas for Tyrosinase: Implications for Vaccine Development. Proc Natl Acad Sci U S A. 92, 8125-8129.
94. Journe, F., Id Boufker, H., Van Kempen, L., Galibert, M. D., Wiedig, M., Sales, F., Theunis, A., Nonclercq, D., Frau, A., Laurent, G., Awada, A., and Ghanem, G. (2011) TYRP1 mRNA Expression in Melanoma Metastases Correlates with Clinical Outcome. Br J Cancer. 105, 1726-1732.
|
Science Writers | Anne Murray |
Illustrators | Peter Jurek |
Authors | Adam Dismang, Tiana Purrington |