Phenotypic Mutation 'cheng' (pdf version)
List |< first << previous [record 65 of 511] next >> last >|
Allelecheng
Mutation Type missense
Chromosome15
Coordinate11,025,868 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Chromosomal Location 11,000,721-11,029,233 bp (+)
MGI Phenotype Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age.
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022851] [ENSMUSP00000112408]
SMART Domains Protein: ENSMUSP00000022851
Gene: ENSMUSG00000022243
AA Change: S435P

DomainStartEndE-ValueType
Pfam:MFS_2 34 262 2.4e-17 PFAM
Pfam:MFS_1 36 363 3e-13 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.96)
(Using ENSMUST00000022851)
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: S435P

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000117100)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All alleles(19) : Targeted(3) Spontaneous(7) Chemically induced(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 missense probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 nonsense
draco2 UTSW 15 11000817 missense probably null 0.05
galak UTSW 15 11012667 nonsense
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.01
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038238-MU
Last Updated 12/07/2016 11:49 AM by Anne Murray
Record Created 05/01/2013 8:38 AM by Adam Dismang
Record Posted 03/28/2014
Phenotypic Description
Figure 1. The cheng mice have a light brown coat.

The cheng mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals. The mutant mice exhibit a tan/beige coat color and black eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 28 mutations. A mutation in Slc45a2 was presumed to be causative because the cheng phenotype mirrored the cardigan phenotype attributed to Slc45a2. The mutation in Slc45a2 is a T to C transition at base pair 11025868 bp (v38) on chromosome 15, or base pair 25,148 in the GenBank genomic region NC_000081. The mutation corresponds to residue 1399 in the mRNA sequence (NM_053077.3) in exon 6 of 7 total exons.

 

1381 TCTATGTTTGGTGTAATGTCCAGCACATTGTACACTGTG

 429 -S--M--F--G--V--M--S--S--T--L--Y--T--V-

 

The mutated nucleotide is indicated in red.  The mutation results in a substitution of serine (S) to a proline (P) at residue 435 in the SLC45A2 protein.

Protein Prediction
Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The cheng mutation (red asterisk) causes a serine to proline substitution at amino acid 435 of the SLC45A2 protein. This image is interactive. Click on the image to view other mutations (red, phenotypic; blue, incidental) found in SLC45A2. Click on the mutations for more specific information.  

The cheng mutation occurs in the tenth transmembrane domain of the SLC45A2 protein (Figure 2). It is unknown whether normal levels of the altered protein exist in cheng mice.

 

Please see the record for cardigan for more information about Slc45a2.

Putative Mechanism

The cheng mutation results in a S435P change in the tenth transmembrane domain of SLC45A2.  The cheng allele is a duplicate of the uwd allele, which also causes a S435P change as a result of a spontaneous mutation in the TF/Le inbred strain at The Jackson Laboratory [(1); MGI:1857540]. Sweet et al. determined that the degree of hypopigmentation of the eyes and fur was dependent on the genetic background, but all uwd mutants were lighter than their unaffected littermates (1). Serine is a polar, uncharged amino acid.  Changing to nonpolar proline could disrupt structure, especially as proline has a rigid structure and often disrupts secondary structure motifs. The coat color of homozygous cheng mice most closely resembles that of homozygous Uwdbr mice and the june gloom mice. These animals are light beige with dark eyes (as adults) on a nonagouti (black) background.

Primers PCR Primer
cheng(F):5'- AGATATTGTGCGGCACTGCCAG -3'
cheng(R):5'- GCAAGAAATGCCACCATGCTTCTC -3'

Sequencing Primer
cheng_seq(F):5'- AGCTGTAATTTTCCCCCCTTTATTC -3'
cheng_seq(R):5'- CCTTAGATCAGGGGTAGCATCAC -3'
Genotyping

Cheng genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Cheng(F): 5’- AGATATTGTGCGGCACTGCCAG -3’

Cheng(R): 5’- GCAAGAAATGCCACCATGCTTCTC -3’

 

Sequencing Primer

Cheng_seq(F): 5’- AGCTGTAATTTTCCCCCCTTTATTC -3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 629 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:

 

   1 agatattgtg cggcactgcc agctgtaatt ttcccccctt tattctctct acagactttc

 61 agaaagctat ggtctcctac attggattaa aaggccttta tttcatggga tatttgctct

121 ttggcctggg aacaggattc ataggactct ttccaaatgt gtactctact ctggtcctct

181 gttctatgtt tggtgtaatg tccagcacat tgtacactgt gccctttaac ctcattgctg

241 agtaccaccg tgaagaggag aaagaggtgg gtgacaaagg gaatttacct caaggataag

301 ggaaggaagg aaggaaggaa ggaaggcaga aggatgctta aacaagtata accatgcaaa

361 catgactaca aagctaggag agttctctct ttgctgtgaa tccctatgca ccttttgaat

421 tttaggacaa tgatagtgac cccaaatatc tgattaaagt aggtaggctc actgatgatg

481 agaaatgagt ccttgatcag actgagacaa agaggcccta tgtcttttgc aaccactcta

541 aggagctttc aacatcgcag catttctaga tgcccacagt gatgctaccc ctgatctaag

601 gtacagagaa gcatggtggc atttcttgc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsAdam Dismang, Tiana Purrington
List |< first << previous [record 65 of 511] next >> last >|