Phenotypic Mutation 'cheng'

• Allele: cheng
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 11,025,954 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Slc45a2
• Gene Name: solute carrier family 45, member 2
• Synonym(s): Aim1, Dbr, blanc-sale, dominant brown, Aim-1, Matp, bls, Oca4
• Chromosomal Location: 11,000,807-11,029,319 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] ; PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000112408]
• AlphaFold: P58355
• SMART Domains: Protein: ENSMUSP00000022851; Gene: ENSMUSG00000022243; AA Change: S435P

Domain	Start	End	E-Value	Type
Pfam:MFS_2	34	262	2.4e-17	PFAM
Pfam:MFS_1	36	363	3e-13	PFAM
transmembrane domain	365	387	N/A	INTRINSIC
transmembrane domain	394	416	N/A	INTRINSIC
transmembrane domain	421	443	N/A	INTRINSIC
transmembrane domain	477	499	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.96)
  (Using ENSMUST00000022851)
• SMART Domains: Protein: ENSMUSP00000112408; Gene: ENSMUSG00000022243; AA Change: S435P

Domain	Start	End	E-Value	Type
Pfam:MFS_2	1	457	2e-22	PFAM
Pfam:MFS_1	2	292	2.6e-12	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000117100)
• Meta Mutation Damage Score: 0.8706
• Is this an essential gene?: Probably nonessential (E-score: 0.073)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 038238-MU
• Last Updated: 2018-08-01 4:38 PM by Diantha La Vine
• Record Created: 2013-05-01 8:38 AM by Adam Dismang
• Record Posted: 2014-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Adam Dismang, Tiana Purrington

Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Alleles Listed at MGI

All alleles(19) : Targeted(3) Spontaneous(7) Chemically induced(9)

Phenotypic Description

Figure 1. The cheng mice have a light brown coat.

The cheng mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals. The mutant mice exhibit a tan/beige coat color and black eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 28 mutations. A mutation in Slc45a2 was presumed to be causative because the cheng phenotype mirrored the cardigan phenotype attributed to Slc45a2. The mutation in Slc45a2 is a T to C transition at base pair 11025868 bp (v38) on chromosome 15, or base pair 25,148 in the GenBank genomic region NC_000081. The mutation corresponds to residue 1399 in the mRNA sequence (NM_053077.3) in exon 6 of 7 total exons.

1381 TCTATGTTTGGTGTAATGTCCAGCACATTGTACACTGTG

 429 -S--M--F--G--V--M--S--S--T--L--Y--T--V-

The mutated nucleotide is indicated in red.  The mutation results in a substitution of serine (S) to a proline (P) at residue 435 in the SLC45A2 protein.

Protein Prediction

Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The cheng mutation (red asterisk) causes a serine to proline substitution at amino acid 435 of the SLC45A2 protein. This image is interactive. Click on the mutations for more specific information.  

The cheng mutation occurs in the tenth transmembrane domain of the SLC45A2 protein (Figure 2). It is unknown whether normal levels of the altered protein exist in cheng mice.

Please see the record for cardigan for more information about Slc45a2.

Putative Mechanism

The cheng mutation results in a S435P change in the tenth transmembrane domain of SLC45A2.  The cheng allele is a duplicate of the uw^d allele, which also causes a S435P change as a result of a spontaneous mutation in the TF/Le inbred strain at The Jackson Laboratory [(1); MGI:1857540]. Sweet et al. determined that the degree of hypopigmentation of the eyes and fur was dependent on the genetic background, but all uw^d mutants were lighter than their unaffected littermates (1). Serine is a polar, uncharged amino acid.  Changing to nonpolar proline could disrupt structure, especially as proline has a rigid structure and often disrupts secondary structure motifs. The coat color of homozygous cheng mice most closely resembles that of homozygous Uw^dbr mice and the june gloom mice. These animals are light beige with dark eyes (as adults) on a nonagouti (black) background.

Primers

PCR Primer
cheng_pcr_F: AGATATTGTGCGGCACTGCCAG
cheng_pcr_R: GCAAGAAATGCCACCATGCTTCTC

Genotyping

Cheng genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Cheng(F): 5’- AGATATTGTGCGGCACTGCCAG -3’

Cheng(R): 5’- GCAAGAAATGCCACCATGCTTCTC -3’

Sequencing Primer

Cheng_seq(F): 5’- AGCTGTAATTTTCCCCCCTTTATTC -3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 629 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:

   1 agatattgtg cggcactgcc agctgtaatt ttcccccctt tattctctct acagactttc

 61 agaaagctat ggtctcctac attggattaa aaggccttta tttcatggga tatttgctct

121 ttggcctggg aacaggattc ataggactct ttccaaatgt gtactctact ctggtcctct

181 gttctatgtt tggtgtaatg tccagcacat tgtacactgt gccctttaac ctcattgctg

241 agtaccaccg tgaagaggag aaagaggtgg gtgacaaagg gaatttacct caaggataag

301 ggaaggaagg aaggaaggaa ggaaggcaga aggatgctta aacaagtata accatgcaaa

361 catgactaca aagctaggag agttctctct ttgctgtgaa tccctatgca ccttttgaat

421 tttaggacaa tgatagtgac cccaaatatc tgattaaagt aggtaggctc actgatgatg

481 agaaatgagt ccttgatcag actgagacaa agaggcccta tgtcttttgc aaccactcta

541 aggagctttc aacatcgcag catttctaga tgcccacagt gatgctaccc ctgatctaag

601 gtacagagaa gcatggtggc atttcttgc

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References

  1. Sweet, H. O., Brilliant, M. H., Cook, S. A., Johnson, K. R., and Davisson, M. T. (1998) A New Allelic Series for the Underwhite Gene on Mouse Chromosome 15. J Hered. 89, 546-551.