Phenotypic Mutation 'Kat'

• Allele: Kat
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 79,047,519 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Sox10
• Gene Name: SRY (sex determining region Y)-box 10
• Synonym(s): Sox21, gt
• Chromosomal Location: 79,039,113-79,048,690 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for null mutations lack peripheral glial cells, melanocytes, and autonomic and enteric neurons, and die neonatally or sooner. Heterozygotes exhibit white spotting and megacolon. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000039466] [ENSMUSP00000155639] [ENSMUSP00000155574]
• AlphaFold: Q04888
• SMART Domains: Protein: ENSMUSP00000039466; Gene: ENSMUSG00000033006; AA Change: E133G

Domain	Start	End	E-Value	Type
Pfam:Sox_N	12	93	1.8e-31	PFAM
HMG	103	173	8.16e-27	SMART
low complexity region	183	205	N/A	INTRINSIC
low complexity region	238	245	N/A	INTRINSIC
low complexity region	310	332	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000040019)
• Predicted Effect: probably benign
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000230532)
• Meta Mutation Damage Score: 0.9515
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Live Mice
• MMRRC Submission: 036992-MU
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: 2013-05-08 2:37 PM by Jennifer Weatherly
• Record Posted: 2014-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Jennifer Weatherly Tiana Purrington

Accession Number

NCBI RefSeq: NM_011437; MGI: 98358

Alleles Listed at MGI

All alleles(14) : Targeted(9) Spontaneous(2) Chemically induced(1) Radiation induced(2)

Phenotypic Description

Figure 1. The Kat heterozygote has variable white spotting on the belly and white feet.

Kat was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant that exhibits variable white spotting on the stomach and white feet (Figure 1).

It is unknown whether homozygous Kat mutants are viable. Heterozygotes are viable and fertile with no gross abnormalities. Kat heterozygotes observed to date survived past weaning age, when most Sox10^Dom heterozygotes die (C57BL/6 background)  (1-3). Kat heterozygotes have not been examined for other known Sox10 mutant phenotypes including hearing deficits, central or peripheral demyelination, or enlargement of the colon.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 99 mutations. Five affected G3 mice from the Kat pedigree were genotyped at all 99 mutation sites.  All five mice were heterozygous for a mutation in Sox10 on chromosome 15. Four other mutations (in Pogz, Enpep, Arhgef10, and Arhgap39) were also heterozygous in all five affected G3 mice; however, the Kat phenotype mimicked that of other Sox10 alleles. Subsequent analysis of three additional Kat mouse (heterozygous) and four unaffected mice (all wild-type for the Sox10 allele) suggested that the Sox10 mutation may be causative for the Kat phenotype, which follows a dominant inheritance pattern (LOD=2.26). The mutation is an A to G transition at base pair 79163319 (v38) on chromosome 15, or base pair 1172 in the GenBank genomic region NC_000081 encoding Sox10. The mutation corresponds to residue 685 in the NM_011437.1 mRNA sequence in exon 2 of 4 total exons.

669 CACCTCCACAATGCTGAGCTCAGCAAGACACTA

128 -H--L--H--N--A--E--L--S--K--T--L-

The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to glycine (G) substitution at residue 133.

Protein Prediction

Figure 2. Domain structure of SOX10. The position of the Kat mutation is indicated and results in a conversion of glutamic acid to glycine at amino acid 133. HMG, High mobility group; TAD, Transcription-activation domain.

The Kat mutation (E133G) is within the DNA-binding HMG (high-mobility-group) domain of the SOX10 protein (Figure 2). Changes in the amino acid sequence within this domain may alter the DNA-binding structure and function of SOX10. The expression, localization, and stability of the mutant protein have not been examined.

Please see the record Dalmatian for information about Sox10.

Putative Mechanism

SOX10 functions in stem cell maintenance and maintains multipotency of early neural crest cells (4;5), but is also involved in specifying and differentiating peripheral glia, melanocytes, and components of the gut nervous system from neural crest cells later in development (2;3;6-12).  Heterozygosity for mutations in mouse Sox10 (e.g., Sox10^Dom (MGI:1857401) and Dalmatian) has been documented to result in variable white spotting of the coat over portions of the body, tail, and feet due to defects in melanocyte development leading to the absence of melanocytes in those areas (1;2). 

Primers

PCR Primer
Kat_pcr_F: ATGACAAGTTCCCCGTGTGCATCC
Kat_pcr_R: AGACCAGCTCTCTCCCAAAGTTTCC

Genotyping

Kat genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

PCR Primers

Kat(F): 5’- ATGACAAGTTCCCCGTGTGCATCC- 3’

Kat(R): 5’- AGACCAGCTCTCTCCCAAAGTTTCC- 3’

Sequencing Primer

Kat_seq(R): 5’- CCACAGAGGCACTTTGGGTAG-3’


PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 667 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Sox10) is amplified:

968         atg acaagttccc cgtgtgcatc cgcgaggcgg tcagccaggt gctcagcggc

1021 tacgactgga cgctggtgcc catgcccgtg cgcgtcaacg gtgccagcaa gagcaagccg

1081 cacgtcaaga ggcccatgaa cgccttcatg gtgtgggcac aggcggcacg cagaaagcta

1141 gccgaccagt accctcacct ccacaatgct gagctcagca agacactagg caagctctgg

1201 aggtgagcgc tgccccggcc caacaccccc ctcgtgcgcg cgcactaggg ctagcctggg

1261 accccagaac aggatcgccc aggcctctct ctcaggggag accaacctat ggaagtttgg

1321 tctcttggaa gaccagattt ggagatctcg cccacccatc tacccaaagt gcctctgtgg

1381 ggggctcctc tggctgccca ctctggaact cagaacccca gcggcctagg ctgggcctcc

1441 ccaccctggg acggcgggcg ggaaggcgcc ccctcgtggt tggaattctg tgggtggtgg

1501 gcagggaagg caacatgggg gtgtggggga aagcttcaca ccagacctcc actagatcgc

1561 acattcacag tgtgccgctg ccacccgttt gtggggtcgg gagtgtgggg gaaactttgg

1621 gagagagctg gtct

Sense strand shown. Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (A>G on the sense strand; T>C on the Chr. + strand).

References

  1. Lane, P. W., and Liu, H. M. (1984) Association of Megacolon with a New Dominant Spotting Gene (Dom) in the Mouse. J Hered. 75, 435-439.

  2. Southard-Smith, E. M., Kos, L., and Pavan, W. J. (1998) Sox10 Mutation Disrupts Neural Crest Development in Dom Hirschsprung Mouse Model. Nat Genet. 18, 60-64.

  3. Herbarth, B., Pingault, V., Bondurand, N., Kuhlbrodt, K., Hermans-Borgmeyer, I., Puliti, A., Lemort, N., Goossens, M., and Wegner, M. (1998) Mutation of the Sry-Related Sox10 Gene in Dominant Megacolon, a Mouse Model for Human Hirschsprung Disease. Proc Natl Acad Sci U S A. 95, 5161-5165.

  4. Sommer, L. (2005) Checkpoints of Melanocyte Stem Cell Development. Sci STKE. 2005, e42.

  5. Kim, J., Lo, L., Dormand, E., and Anderson, D. J. (2003) SOX10 Maintains Multipotency and Inhibits Neuronal Differentiation of Neural Crest Stem Cells. Neuron. 38, 17-31.

  6. Wegner, M. (2005) Secrets to a Healthy Sox Life: Lessons for Melanocytes. Pigment Cell Res. 18, 74-85.

  7. Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I., Rossner, M., Nave, K. A., Birchmeier, C., and Wegner, M. (2001) The Transcription Factor Sox10 is a Key Regulator of Peripheral Glial Development. Genes Dev. 15, 66-78.

  8. Stolt, C. C., Rehberg, S., Ader, M., Lommes, P., Riethmacher, D., Schachner, M., Bartsch, U., and Wegner, M. (2002) Terminal Differentiation of Myelin-Forming Oligodendrocytes Depends on the Transcription Factor Sox10. Genes Dev. 16, 165-170.

  9. Bondurand, N., Pingault, V., Goerich, D. E., Lemort, N., Sock, E., Le Caignec, C., Wegner, M., and Goossens, M. (2000) Interaction among SOX10, PAX3 and MITF, Three Genes Altered in Waardenburg Syndrome. Hum Mol Genet. 9, 1907-1917.

  10. Potterf, S. B., Furumura, M., Dunn, K. J., Arnheiter, H., and Pavan, W. J. (2000) Transcription Factor Hierarchy in Waardenburg Syndrome: Regulation of MITF Expression by SOX10 and PAX3. Hum Genet. 107, 1-6.

  11. Potterf, S. B., Mollaaghababa, R., Hou, L., Southard-Smith, E. M., Hornyak, T. J., Arnheiter, H., and Pavan, W. J. (2001) Analysis of SOX10 Function in Neural Crest-Derived Melanocyte Development: SOX10-Dependent Transcriptional Control of Dopachrome Tautomerase. Dev Biol. 237, 245-257.

  12. Rehberg, S., Lischka, P., Glaser, G., Stamminger, T., Wegner, M., and Rosorius, O. (2002) Sox10 is an Active Nucleocytoplasmic Shuttle Protein, and Shuttling is Crucial for Sox10-Mediated Transactivation. Mol Cell Biol. 22, 5826-5834.