Phenotypic Mutation 'waffle' (pdf version)
Allelewaffle
Mutation Type missense
Chromosome7
Coordinate87,142,429 bp (GRCm39)
Base Change T ⇒ C (forward strand)
Gene Tyr
Gene Name tyrosinase
Synonym(s) skc35, Oca1
Chromosomal Location 87,073,979-87,142,637 bp (-) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011661; Ensembl: ENSMUST00000004770; MGI: 98880

MappedYes 
Amino Acid Change Serine changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004770] [ENSMUSP00000146757]
AlphaFold P11344
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: S44G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
(Using ENSMUST00000004770)
Predicted Effect unknown
Meta Mutation Damage Score 0.8929 question?
Is this an essential gene? Probably nonessential (E-score: 0.148) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(121) : Targeted(2) Spontaneous(29) Chemically induced(16) Radiation induced(78)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87087156 missense probably damaging 1.00
IGL01594:Tyr APN 7 87133022 splice site probably benign
IGL02963:Tyr APN 7 87133205 missense probably benign
IGL03356:Tyr APN 7 87141922 missense possibly damaging 0.71
ghost UTSW 7 87121703 missense probably damaging 1.00
pale UTSW 7 87087175 missense probably damaging 1.00
pale_rider UTSW 7 87087231 missense probably damaging 1.00
rufus UTSW 7 87141914 missense probably damaging 1.00
shocked UTSW 7 87142330 missense probably damaging 1.00
siamese UTSW 7 87087252 missense probably damaging 0.99
Venusaur UTSW 7 87141914 missense probably damaging 1.00
R0322:Tyr UTSW 7 87142125 missense probably benign 0.35
R0479:Tyr UTSW 7 87142429 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87141914 missense probably damaging 1.00
R1546:Tyr UTSW 7 87087200 missense probably benign 0.02
R1606:Tyr UTSW 7 87087179 missense probably benign 0.01
R1666:Tyr UTSW 7 87142149 missense probably damaging 1.00
R2064:Tyr UTSW 7 87142051 missense probably benign 0.13
R2213:Tyr UTSW 7 87142086 missense probably damaging 1.00
R2420:Tyr UTSW 7 87078397 missense probably benign 0.17
R4013:Tyr UTSW 7 87087148 missense probably benign 0.00
R4014:Tyr UTSW 7 87087148 missense probably benign 0.00
R4015:Tyr UTSW 7 87087148 missense probably benign 0.00
R4016:Tyr UTSW 7 87087148 missense probably benign 0.00
R4202:Tyr UTSW 7 87078276 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87078276 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87078276 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87078284 missense probably benign 0.01
R4738:Tyr UTSW 7 87141855 missense probably null 1.00
R5306:Tyr UTSW 7 87087222 missense probably damaging 1.00
R5378:Tyr UTSW 7 87121703 missense probably damaging 1.00
R5395:Tyr UTSW 7 87121698 missense probably damaging 0.98
R5782:Tyr UTSW 7 87142224 missense probably damaging 1.00
R7007:Tyr UTSW 7 87142548 missense probably benign 0.04
R7609:Tyr UTSW 7 87133092 missense probably benign 0.06
R7767:Tyr UTSW 7 87142218 missense probably benign 0.37
R7794:Tyr UTSW 7 87133028 critical splice donor site probably null
R8158:Tyr UTSW 7 87121724 missense probably damaging 0.99
R8383:Tyr UTSW 7 87133200 missense probably damaging 1.00
R8403:Tyr UTSW 7 87087175 missense probably damaging 1.00
R8544:Tyr UTSW 7 87142000 missense probably benign 0.05
R8822:Tyr UTSW 7 87142330 missense probably damaging 1.00
R8837:Tyr UTSW 7 87087223 missense probably damaging 1.00
R9492:Tyr UTSW 7 87121705 missense possibly damaging 0.63
R9492:Tyr UTSW 7 87121704 missense probably damaging 1.00
R9748:Tyr UTSW 7 87142072 missense possibly damaging 0.89
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 036996-MU
Last Updated 2016-07-13 2:46 PM by Anne Murray
Record Created 2013-05-08 2:48 PM by Jennifer Weatherly
Record Posted 2016-07-13
Phenotypic Description
Figure 1. The waffle homozygotes have a light tan or yellow coat color.

The waffle mutation was induced by N-ethyl-N-nitrosourea (ENU) mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals. Homozygous waffle mice exhibit a light tan/yellow coat color and black eyes (Figure 1).
Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 99 mutations. Three affected G3 mice from the waffle pedigree were genotyped at 99 mutation sites and all three mice were homozygous for a mutation in Tyr on chromosome 7. Subsequent analysis of an additional waffle mouse (homozygous for the Tyr mutation) and six unaffected mice (all heterozygous or wild-type for the Tyr locus) supported the Tyr mutation as causative for the waffle phenotype (LOD=5.107). 

The waffle mutation is an A to G transition at base pair 87493221 (v38) on chromosome 7, or base pair 191 in the GenBank genomic region NC_000073 encoding Tyr. The mutation corresponds to residue 191 in the NM_011661.4 mRNA sequence in exon 1 of 5 total exons.

176 TGGATGGGTGATGGGAGTCCCTGCGGCCAGCTT

39  -W--M--G--D--G--S--P--C--G--Q--L-

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to glycine (G) substitution at residue 44 in the Tyr protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 2. Domain structure of tyrosinase. The waffle mutation causes a serine to glycine substitution at residue 44 of tyrosinase. SP, signal peptide; EGF-like, epidermal growth factor-like laminin domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light and dark pink, respectively. Click on the image to view other mutations found in TYR. Click on each mututation for more specific information.

The residue altered by the waffle mutation (Ser44) occurs N-terminal to the epidermal growth factor (EGF)-like laminin domain in the Tyr protein; Ser44 has no known function (Figure 2).

Please see the record ghost for information about Tyr.

Putative Mechanism

The waffle mutation causes a weak form of albinism, similar to the spontaneous Tyrc-e allele (extreme dilution; MGI:1855978). Homozygous Tyrc-e mice have pigmented eyes with an off-white/yellow coat that darkens to a brownish shade with age (1). Because waffle mice are not completely white, it is likely that the mutation is hypomorphic and Tyrwaffle retains residual activity sufficient for some pheomelanin but not eumelanin production to occur (2).

During melanosome biogenesis and maturation, transport vesicles traffic melanosomal proteins (e.g., Tyr, Tyrp1 (Tyr-related protein 1; see the record for chi), lysosome-associated membrane protein (Lamp), and gp100 (Pmel17) from the trans-Golgi network (TGN) to the melanosomal compartment (3). Regulation of trafficking may be distinct for eumelanosomes, to which Tyr, Tyrp1, and DCT (dopachrome tautomerase) are transported from the TGN, versus pheomelanosomes, to which only Tyr is transported from stage I melanosomes to stage II melanosomes.  Thus, an alternative mechanism for the waffle mutation may be to impair the ability of the mutant Tyr to traffic to eumelanosomes but not pheomelanosomes.

The waffle mouse may be a model for oculocutaneous albinism (OCA1) as a Ser44Gly mutation has been identified in a human patient with OCA1 (4). OCA1 can be subdivided into two phenotypes: OCA1A (OMIM: #203100) and OCA1B (OMIM: #606952). Type 1A is characterized by a complete lack of Tyr activity and melanin synthesis resulting in white hair, skin, and blue eyes. Type IB is characterized by reduced Tyr activity; patients have yellow or blond hair (with age). Since waffle mice appear to retain some pigmentation, they may represent a model of OCA1B.  The subtype of OCA1 that the Ser44Gly patient presented with was not discussed.

Primers PCR Primer
waffle_pcr_F: TGTGGGGATGACATAGACTGAGCTG
waffle_pcr_R: TCACTCCAGGGGTTGCTGGAAAAG

Genotyping
DNA trace (Chr. + strand) showing the waffle mutation.

Waffle genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

PCR Primers

Waffle(F): 5’- TGTGGGGATGACATAGACTGAGCTG -3’

Waffle(R): 5’- TCACTCCAGGGGTTGCTGGAAAAG-3’

Sequencing Primer

Waffle_seq(F): 5’- TTACAGTTTCCGCAGTTGAAACC-3’


PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 540 nucleotides is amplified (Chr. 7: 87492892-87493431, GRCm38):

tgtggggatg acatagactg agctgatagt atgttttgct aaagtgaggt aagaaaagaa

cttattcttt tcggagacac tcaaatcaaa aatgtttctt ctaatcaaga ctcgcttctc

tgtacaattt gggcccccaa atccaaactt acagtttccg cagttgaaac ccatgaagtt

gcctgagcac tggcaggtcc tattataaaa cacagagggc caggactcac ggtcatccac

ccctttgaag gggaactgag gtccagatgg tgcactggac agaaggatat cctggcagga

acctctgcct gaaagctggc cgcagggact cccatcaccc atccatggtg ggcagcattc

ttttgccaac aagttcttag aggaggcaca ggctcgagga aaatggccat cagagatctg

gaaactccac agaaggcaat acaaaacagc caagaacatt ttctccttta gatcatacaa

aatctgcacc aataggttaa tgagtgtcac agacttcttt tccagcaacc cctggagtga

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>C, Chr. + strand; A>G, sense strand).

References
  1. Detlefsen, J. A. (1921) A New Mutation in the House Mouse. Amer Nat. 55, 469-473.
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsJennifer Weatherly Tiana Purrington