Phenotypic Mutation 'chestnut' (pdf version)
List |< first << previous [record 68 of 511] next >> last >|
Allelechestnut
Mutation Type splice donor site (6 bp from exon)
Chromosome3
Coordinate94,377,609 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Rorc
Gene Name RAR-related orphan receptor gamma
Synonym(s) Thor, thymus orphan receptor, RORgamma
Chromosomal Location 94,372,831-94,397,839 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL.
Accession Number

NCBI RefSeq: NM_011281.2; MGI: 104856

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000143763] [ENSMUSP00000143610]
SMART Domains Protein: ENSMUSP00000102913
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Predicted Effect
Phenotypic Category decrease in CD4+ T cells, decrease in CD8+ T cells
Penetrance  
Alleles Listed at MGI

All alleles(6) : Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
macadamias UTSW 3 94397302 nonsense probably null
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
JAX1:Rorc UTSW 3 94388762 missense probably damaging 1.00
JAX1:Rorc UTSW 3 94391173 missense probably damaging 1.00
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense possibly damaging 0.79
R2510:Rorc UTSW 3 94389120 missense probably benign 0.09
R4135:Rorc UTSW 3 94389519 missense probably damaging 0.97
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense possibly damaging 0.74
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
MMRRC Submission 037090-MU
Last Updated 12/07/2016 11:50 AM by Anne Murray
Record Created 05/10/2013 12:57 PM by Ming Zeng
Record Posted 02/13/2014
Phenotypic Description
Figure 1. Chestnut mice exhibited deficiency in CD4+ (top graph) and CD8+ (bottom graph) T cells.
Figure 2. Flow cytometric analysis of B and T cells in chestnut mice. Shown is a representative flow cytometry analysis. (Top) The chestnut mouse (T2947) had reduced numbers of T cells compared to the C57BL/6J (B6) mouse. (Bottom) Analysis of CD4and CD8T cell subsets determined that both the CD4and CD8+ subsets were reduced in chestnut compared to the B6 control.
Figure 3. Percentages of hematopoietic cells in the chestnut mouse. Flow cytometric analysis determined the percentages of parent cells in the chestnut mice compared to the wild-type mice.

The chestnut phenotype was initially identified among G3 mice carrying mutations induced by N-ethyl-N-nitrosourea (ENU) and tested in the flow cytometric screen for deficiencies of peripheral blood cells. Chestnut mice exhibited deficiency in CD4+ and CD8+ T cells; other hematopoietic cell subsets were not significantly changed compared to the wild-type controls (Figure 1-3). 

Nature of Mutation

Figure 4. RT-PCR analysis of the Rorγt isoform in chestnut thymus and spleen. (A)  RORγt cDNA and primer binding sites used in RT-PCR and sequencing. The forward primer was designed upstream of the ATG codon in exon 1γt and the reverse primer within exon 3γt. The sequencing primer is also in exon 3γt. (B) RT-PCR results using the primers shown in (A). Gapdh was used as the control.

Whole exome HiSeq sequencing of the G1 grandsire identified 80 mutations. Three G3 mice with the chestnut phenotype were genotyped at all 80 mutation sites and four mutations on chromosome 3 affecting Trpc3, Frem2, Gucy1b3, and Rorc were homozygous in all three of the chestnut mice. Subsequent analysis of five additional affected mice and 14 unaffected mice supported a causal relationship between the mutation in Rorc and the chestnut phenotype (LOD = 5.12); of the four mutations, only the Rorc mutation was homozygous in all eight affected mice. The mutation is a T to C transition at base pair 94,377,609 (v38) on chromosome 3 within the linear genomic DNA sequence of Rorc (GenBank genomic region NC_000069).  The mutation affects the intron 1 donor splice site of the Rorc splice variant encoding Rorγt (GTAAGT-->GTAAGC; ENSMUST00000107292), but is not expected to affect the splice variant encoding Rorγ1.  

 

RT-PCR and sequencing analysis were used to examine Rorγt splicing in chestnut tissues. Using primers spanning exons 1-3 (5’-GTGGAGCAGAGCTTAAACCCC-3’; 5’-CATCTCGGGACATGCCCAGAG-3’) (Figure 4A), RT-PCR of thymus and spleen mRNA showed that Rorγt expression was reduced in homozygous chestnut mice compared to wild-type mice (Figure 4B). Sequence analysis determined that the cDNA amplified from chestnut tissue was identical to the wild-type cDNA, indicating that the mutation does not completely abolish the function of the intron 1 donor splice site.  It remains possible that a cryptic donor splice site in the 5’ UTR is used for splicing to the intron 1 acceptor splice site, but the resulting transcript degraded by the nonsense mediated decay pathway.  Possible partial or complete retention of intron 1 in the spliced mRNA was not tested.  Reduced expression of Rorγt may account for the observed phenotype.

Protein Prediction

Figure 5. Rorc encodes two isoforms. (A) The genomic organization of Rorc. Exons are labeled with their isoform-specific numbers (γ1, RORγ1; γt, RORγt). The first exon of the RORγt isoform is colored red. The Chestnut mutation affects the splice donor site of the first intron of the RORγt isoform. (B) Domain organization of mouse RORγt and RORγ1.  DBD, DNA binding domain; CTE, carboxy-terminal extension; LBD, ligand binding domain.

Figure 6. Crystal structure of human RORγ ligand binding domain. The RORγ LBD is comprised of 12 α-helices and two short β-strands folded into a three-layer helix sandwich. The nuclear receptor coactivator 2 is in gold. The orange denotes the β-strands. The hydroxycholesterol ligand is a blue ball and stick figure in the center of the structure. The figure modeled using Chimera from PDB:3KYT and (8).

RAR-related orphan receptor gamma (RORγ) is a member of the RAR-related orphan nuclear hormone receptor transcription factor family that includes RORα and RORβ (see the record for 4-limb clasper for information about RORβ). Nuclear hormone receptors, including the ROR proteins, are structurally similar and each has an N-terminal domain (A/B region), a DNA-binding domain (DBD), a hinge domain, and a C-terminal ligand-binding domain (LBD) [Figure 5; reviewed in (1)]. The ROR proteins are highly conserved: the DBDs are approximately 90% identical and LBDs are 48% and 46% identical, respectively, between RORγ and RORα or RORβ [(2); reviewed in (3)]. The ROR proteins generally bind as monomers to retinoic acid-related orphan receptor response elements (ROREs; AGGTCA immediately preceded by a 6-bp A/T-rich region) in target genes.  Once bound to ROREs, RORs constitutively recruit coactivators to activate transcription (2;4-6). For more information about these domains, please see the record for 4-limb clasper.

 

Few endogenous ligands have been described for RORγ. However, structural analyses provided evidence that 7-oxygenated sterols (e.g., 7-α-hydroxycholesterol, an intermediate in bile acid metabolism) may be natural ligands for both RORα and RORγ through binding to their LBDs (7). The LBD of human RORγ in complex with the second LxxLL motif of nuclear receptor coactivator 2 (NCOA2; alternatively, SRC2) and several hydroxycholesterol (HC) ligands (20α-HC, 22R-HC, and 25-HC) has been crystallized [Figure 6; PDB:3KYT; (8)]. The RORγ LBD is comprised of 12 α-helices and two short β-strands folded into a three-layer helix sandwich, similar to other ROR LBDs (8). The three RORγ LBD-HC structures were similar overall and the HCs adopted the same position in the ligand-binding pocket (8). The HC ligands were enclosed within the bottom half of the LBD and were oriented with the hydroxyl tail toward helix H11 of the LBD and the A ring toward helices H1 and H2 (8). RORγ interacts with the coactivator SRC2 via a charge clamp pocket formed by residues from the activation function (AF-2) motif at the C-terminal end of the LBD and helices H3, H4, and H5 (8).

 

Rorc generates two isoforms of RORγ, RORγ1 and RORγt (alternatively, RORγ2), by the use of alternative promoters and/or by alternative splicing of a common pre-mRNA (9-13). The RORγ isoforms have the same DBDs and LBDs, but RORγt lacks the N-terminal 24 amino acids of RORγ1 encoded by the first two exons of Rorc and has three alternative residues encoded by the first exon specific to RORγt [Figure 5; (9;13); reviewed in  (3;14;15)].

 

The chestnut mutation is predicted to weaken the intron 1 donor splice site, resulting in retention of all or a portion of intron 1, and/or skipping of exon 1 in the processed RORγt mRNA.  It is unknown whether a non-functional protein is translated, or if the mutant transcript is subject to nonsense mediated decay.  Only the RORγt isoform is predicted to be affected by the chestnut mutation. 

Expression/Localization

RORγ1 and RORγt have different tissue expression patterns [reviewed in (14)]. RORγ1 is expressed in several tissues including liver, kidney, small intestine, brain, brown adipose tissue, skeletal muscle, pancreas, prostate, testis, and thymus (6;10;11). Mongrain et al. detected low levels of RORγ1 in all thymocyte subsets (16). RORγ1 exhibits an oscillatory expression pattern in the liver, thymus, brown adipose tissue, kidney, and small intestine; expression in the muscle and testis is constant (16;17). Examination of several Zeitgeber time- points determined that peak expression of RORγ1 was around Zeitgeber time 16; Zeitgeber time is a standard of time based on the period of a synchronizing agent (16-19). Oscillation of RORγ1 expression is proposed to be mediated by Clock/Bmal1 heterodimers that bind one of the E-boxes (E2) of Rorc (16;17).

 

RORγt is highly expressed in the thymus, with expression restricted to double-positive (DP; CD4+CD8+) thymocytes (6;9;11;13;20). RORγt is downregulated during positive selection and turned off in mature single-positive (SP) thymocytes and peripheral T cells (9;21).  RORγt is also expressed in fetal lymphoid tissue inducer cells [LTi; LTi function in the development of lymph nodes and Peyer’s patches; (9;12;20;22)], IL-17-producing cells [e.g., Th17 cells and γδ T cells (23-25)], NKp46+ NK cells (26;27), and thymic epithelial cells (16). During early embryogenesis RORγt expression by LTi cells has been observed in the spleen (20), but expression was not detectable in the adult spleen (28). Using quantitative PCR with primers specific for the RORγt isoform, Mongrain et al. determined that RORγt mRNA is expressed at very low levels in muscle, testis, and liver (16). They speculate that the differences observed in their findings compared to previous studies are due to the sensitivity of the methods used in their study (16). The function of RORγt in non-immune tissues is unknown and was not speculated (16)

Background

Figure 7. RORγt functions in T cell development and homeostasis. (A) Summary of T cell development.  The bars indicate the period of expression of cell surface markers, transcription factors, and growth factor receptors, as well as periods of recombinase expression, TCR gene rearrangement and other developmental events.  RORγt is expressed in double-positive cells. Proliferative cells are labeled as "cycling". DN, double-negative (CD4-CD8-‚Äč); DP, double-positive (CD4+CD8+); SP, single-positive (CD4+ CD8(helper T-cell) or CD8+CD4- (cytotoxic T-cell)). (B) The function of RORγt in the differentiation of Th17 cells. TGF-β is necessary for the differentiation of both Th17 and Treg cells from naïve helper T cells.  However, differentiation along the Th17 lineage also requires either IL-6 or IL-21 in addition to TGF-β.  Via STAT3 activation, IL-6 or IL-21 promotes the expression of RORγt, and to a lesser extent RORα; these two RORs display some functional redundancy.  The activation of RORγt and RORα leads to the expression and secretion of Th17-specific cytokines including IL-17, IL-17F, IL-21, and IL-22.  Foxp3 antagonizes the Th17 fate by directly binding to RORγt and RORα and blocking their ability to transactivate target genes.  All trans retinoic acid (ATRA) promotes the Treg cell fate by positively regulating Foxp3 expression and negatively regulating RORγt expression.

The proteins of the nuclear receptor superfamily are DNA-binding proteins that regulate gene expression in response to physiological, metabolic, and nutritional signals such as steroids, retinoids, thyroid hormones, and vitamin D3 [(29); reviewed in (30)]. In doing so, the nuclear receptors regulate cell differentiation, organ physiology, and development. The three members of the ROR family, RORα, RORβ, and RORγ, and their isoforms display distinct tissue expression patterns and thus control the development and function of specific cellular subsets. The function(s) of RORγ1 and RORγt are discussed, below.  Findings based on analysis of mice or cells expressing a null allele of Rorc may implicate either or both RORγ1 and RORγt; the general name “RORγ” is used in these cases to indicate this possibility.

 

RORγt in thymocyte differentiation/maturation

One function of RORγ during thymopoiesis is to negatively regulate DP thymocyte apoptosis to promote cell survival [Figure 7; (31;32); reviewed in (14)]. Thymocytes are greatly reduced in RORγ-null (Rorc-/-; MGI: 2386114; (31;32) and RORγt-deficient mice [MGI:3026635; (12)]. In particular, loss of RORγ expression led to a loss of CD4+CD8+ double positive (DP) as well as CD4+ and CD8+ single positive (SP) thymocytes because of a block in thymocyte development from the immature single positive (CD4-CD8lowCD3-) stage to the DP stage (31;32). RORγt promotes thymocyte survival by activating a program of gene expression that depends on recruitment of the SRC family of transcriptional coactivators (e.g., SRC1 and GRIP1) to the AF2 domain of RORγt [(31-33); reviewed in (28)].  In addition, RORγt positively regulates the expression of the anti-apoptotic protein Bcl-xL, a known regulator of thymocyte survival (34). Thus, DP thymocytes in Rorc-/- mice express greatly reduced levels of Bcl-xL and the RORγ deficient DP thymocytes had a shorter lifespan than wild type DP thymocytes (31;32). Wang et al. identified the β-catenin/T cell factor 1 (TCF-1) pathway as upstream of RORγt in Bcl-xL-mediated DP thymocyte survival regulation (35). DP thymocytes in Rorc-/- mice express lower levels of TCR than those found in normal mice because RORγ regulates TCRα repertoire formation and TCRα gene rearrangement by binding to the T early α (TEA) promoter, a transcription factor that regulates TCRα recombination [(13;31;36;37); reviewed in (3;14)]. In addition to binding to TEA, RORγ also positively regulates Bcl-xL expression, subsequently regulating the TCRα repertoire. In Rorc-/- mice, the 3’ Jα usage was impairedand that Jα usage was skewed to the 5’ end of the locus; the 3’ Jα usage could be corrected upon expression of a Bcl-xL transgene [(36); reviewed in (14)]. Furthermore expression of transgenic Bcl-xL skewed Jα usage to the very 3’ end of the locus and induced a 3’ Jα bias to the peripheral TCRα repertoire in wild-type and Rorc-/- mice (36). RORγ may also facilitate TCR surface expression later in thymocyte development, but this has not been definitively proven [reviewed in (28)].

 

RORγ inhibits expression of Fas ligand (FasL) and interleukin-2 (IL-2), protecting hybridomas from TCR-induced apoptosis [(9;38); reviewed in (14)]. During TCR-induced apoptosis and thymocyte development RORγ inhibits nuclear factor of activated T cells (NFAT) by competing for DNA binding sites, subsequently inhibiting NFAT-regulated transcription; NFAT is a factor that stimulates the transcriptional activation of both FasL and IL-2 (38;39). However, deregulated expression of FasL does not play a role in promoting apoptosis in Rorc-/- DP thymocytes because mutation of Fasl in Rorc-/- mice fails to rescue cell death.  In addition, RORγt negatively regulates the transcription of c-Rel, another regulator of IL-2 expression (21;40).

 

Following antigen activation, CD4+ T cells differentiate into several types of effector and regulatory T (Treg) cells [Figure 7; reviewed in (41)]. Interleukin-17 (IL-17)-producing helper T (TH17) cells are particularly important mediators of host defense against extracellular bacterial pathogens at mucosal barriers in the intestine and airways.  However, in excess they contribute to the development of many autoimmune diseases (e.g., systemic lupus erythematosus, multiple sclerosis, inflammatory colitis, rheumatoid arthritis and psoriasis) by secreting several pro-inflammatory cytokines and chemokines including IL-17A, IL-17F, IL-21, IL-22, TNF, and IL-6 as well as opposing the function of Treg cells [(42;43); reviewed in (41;44)]; immune homeostasis is maintained by balancing the levels of TH17 and Treg cells [reviewed in (41)]. RORγt and RORα promote TGF-β plus IL-6- or IL-21-induced TH17 differentiation and suppress TNF- and IL-1β-induced TH1 and TH2 differentiation (45-50). Signal transducer and activator of transcription 3 (STAT3) and runt-related transcription factor 1 (RUNX1) collaborate with RORγt and RORα to induce expression of Il17a and Il17f, subsequently promoting TH17 differentiation and cytokine expression (48;51-53). RORγt can also activate the gene that encodes IL-23R (the receptor for IL-23) as well as promote the surface expression of the TH17 chemokine receptor CCR6 (23;49;50;52). HIF1α has emerged as a regulator of Rorc transcription that can also bind to RORγt to promote the transcription of RORγt target genes and TH17 differentiation (25;54). HIF1α also can negatively regulate Foxp3 expression posttranslationally (25). Foxp3 suppresses TH17 cell differentiation by directly binding to RORγt and blocking its ability to activate Il17a and Il17f transcription; Foxp3 can also interact with and inhibit Runx1 (55).

 

Development of secondary lymphoid organs

Rorc-/- mice do not have lymph nodes (both peripheral and mesenteric) as well as Peyer’s patches due to the absence of lymphoid tissue inducer (LTi) cells, which require RORγt for their generation and survival through the regulation of Bcl-xL (12;31;32;56).  Studies have shown conflicting results on the splenic structure of Rorc-/- mice (MGI:2384142). Sun et al. reported no change in splenic structure (31), while Zhang et al. reported enlarged spleens due to an accumulation of conventional resting B cells; B lymphocyte development in the bone marrow and spleen in the Rorc-/- mice were normal and B cell levels in the blood were comparable to controls (56).

 

Other functions of RORγ

Circadian behavior

Members of the ROR family, including RORγ1, are involved in the regulation of circadian behavior, likely by coupling the action of circadian-regulatory genes with ROR-controlled metabolic genes (4;16;19). ROR proteins exhibit oscillatory expression patterns in specific tissues.  In particular, RORγ1 expression follows a circadian oscillation in liver, brown adipose tissue, and kidney, where it is expressed at low levels during the day and higher levels at night (16;19).  RORγ1 positively regulates the expression of Bmal1, a circadian clock gene, in liver and muscle (but not testis) (16). RORγ1 has also been shown to regulate the level of expression of other circadian clock genes including Cry1, Rev-Erbα, Per2 and E4bp4 in liver, brown adipose tissue, kidney, and small intestine (19). Microarray analysis of gene expression in RORα- or RORγ-deficient liver demonstrated that RORα and RORγ regulate the expression of numerous genes encoding metabolic enzymes (57).  In several tissues (liver and brown adipose tissue), RORγ and RORα had redundant functions in their regulation of clock and metabolic genes (19;57).

 

Adipocyte differentiation

During adipocyte differentiation, RORγ mRNA and protein expression is high in confluent 3T3-L1 preadipocytes; RORγ is reduced upon the induction of differentiation (58). RORγ has been identified as a factor that negatively regulates adipocyte differentiation at the initial steps of adipogenesis by repressing the early adipogenic gene Mmp3 (58). In addition, mutations in RORC have been linked to fat accumulation in cattle (59). In 3T3-L1 preadipocytes, induction of differentiation to adipocytes results in a decline in both the mRNA and protein levels of RORγ1 (58). In late stages of D1 and 3T3-L1 cell differentiation, RORC expression is upregulated (60).  In cells overexpressing RORγ, adipogenic proteins such as C/ebpα, C/ebpβ, C/ebpδ and Pparγ were decreased; adipogenic genes c-Jun, c-Fos and A-Fabp were also repressed (58)

Putative Mechanism

Chestnut mice exhibit deficiencies of both CD4+ and CD8+ T cells, similar to Rorc-/- [MGI: 2386114; (19;33) and MGI: 2384142; (35)] and RORγt-deficient mice [MGI:3026635; (12)].  Reduction in SP thymocytes is due to a block in thymocyte development from the immature single positive stage to the DP stage, as well as increased apoptosis of the DP thymocytes (19;33;35;38). A consequence of increased thymocyte cell death related to reduced Bcl-xL expression appears to be impaired TCRα rearrangement (14).

Primers PCR Primer
chestnut(F):5'- TGCCTGTCATCATACCCAATGCAC -3'
chestnut(R):5'- ACCATTGCTGCCAAGGAAGCTG -3'

Sequencing Primer
chestnut_seq(F):5'- CTGTGTGGAGCAGAGCTTAAAC -3'
chestnut_seq(R):5'- CCAAGGAAGCTGCCAGG -3'
Genotyping

Chestnut genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

PCR Primers

Chestnut(F): 5’- TGCCTGTCATCATACCCAATGCAC -3’

Chestnut(R): 5’- ACCATTGCTGCCAAGGAAGCTG -3’

 
Sequencing Primer

Chestnut_seq(F): 5’- CTGTGTGGAGCAGAGCTTAAAC -3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 427 nucleotides (from Genbank genomic region NC_000069 for linear DNA sequence of Rorc) is amplified:

 

4547                                                   tgcc tgtcatcata      
4561 cccaatgcac ctctgggggt tggggggctg tcacttggcc acctgtgtgg agcagagctt      
4621 aaacccccct gcccagaaac actgggggag agctttgtgc agatctaagg gctgaggcac      
4681 ccgctgagag ggcttcaccc cacctccact gccagctgtg tgctgtcctg ggctacccta      
4741 ctgaggagga cagggagcca agttctcagt catgagaagt aagtgaatgg gggcatccgg      
4801 tcatggggga gcctgggtcc tgtcaccatt cctaggcccg ctgaatagga gtgtatcttg      
4861 gaaaccgtgc ctctttggca gggtgtgtcc cagtcaaggt caagatctgc tgggagatgg      
4921 gtggagtccc aagagagtta ctcttccctg gcagcttcct tggcagcaat ggt

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Kuan-Wen Wang, Bruce Beutler
List |< first << previous [record 68 of 511] next >> last >|