Phenotypic Mutation 'draco1' (pdf version)
Alleledraco1
Mutation Type missense
Chromosome7
Coordinate56,423,352 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) D7H15S12, p, D7H15S12
Chromosomal Location 56,239,760-56,536,518 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021879; MGI:97454

Mapped Yes 
Amino Acid Change Tyrosine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032633] [ENSMUSP00000119529] [ENSMUSP00000119099]
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: Y765F

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
(Using ENSMUST00000032633)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.66 question?
Is this an essential gene? Probably nonessential (E-score: 0.235) question?
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation 5565073
skin/coat/nails 5565073
Candidate Explorer Status CE: good candidate; human score: -1; ML prob: 0.548
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(85) : Targeted(2) Gene trapped(1) Spontaneous(20) Chemically induced(14) Radiation induced(51)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038243-MU
Last Updated 2018-01-12 4:39 PM by Diantha La Vine
Record Created 2013-05-24 7:09 PM by Tiana Purrington
Record Posted 2014-08-20
Phenotypic Description
Figure 1. Draco1 is a hypopigmentation mutant. The draco1 mice have gray coats and red eyes.

The draco1 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R0440, some of which exhibited a light gray coat and red eyes (Figure 1). Other phenotypes associated with Oca2 mutations such as slight susceptibility to L. monocytogenes (see the records for charbon and quicksilver) have not been examined in draco1 mice.

Nature of Mutation
Figure 2. Linkage mapping of the draco1 phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R0440.  Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. The pigmentation phenotype of the coat and eyes was linked to a mutation in Oca2: an A to T transversion at base pair 56,423,352 (v38) on chromosome 7, or base pair 183,760 in the GenBank genomic region NC_000073 encoding Oca2. Linkage was found with a recessive model of inheritance (P = 9.776 x 10-6), wherein 6 affected mice were homozygous (N = 5) or heterozygous (N = 1) for the variant allele, and 18 unaffected mice were either heterozygous (N = 12) or homozygous for the reference allele (N = 6) (Figure 2). The mutation corresponds to residue 2,424 in the NM_021879 mRNA sequence in exon 22 of 24 total exons. 

 

2408 GCACTGCCTCTCATGTATGCCCTGGCCCTCGGT

760  -A--L--P--L--M--Y--A--L--A--L--G-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine (Y) to phenylalanine (F) substitution at residue 765 in the OCA2 protein.

Protein Prediction
Figure 3. Domain organization of the OCA2 protein. (A) Topography. (B) Domain structure. The draco1 mutation results in a tyrosine to phenylalanine substitution at amino acid 765 in the OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.

The draco1 mutation occurs within transmembrane domain 11 of 12 total transmembrane domains of the OCA2 protein (Figure 3).  Protein expression and localization of OCA2 has not been examined in the draco1 mice.

 

Please see the record quicksilver for information about Oca2.

Putative Mechanism

The draco1 mutation results in an amino acid change (Y765F) within transmembrane domain 11, a region of OCA2 that is highly conserved between mouse and human OCA2; the function of this region is unknown. Mutations in Oca2 are known to cause a variable reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (1;2). For example, mice with null alleles of Oca2 have very little to no eumelanin in their coat and eyes, resulting in a hypopigmentation phenotype: light grey fur with pink eyes on a nonagouti background (e.g., C57BL/6J), and cream-colored mice on an agouti background (3;4). The null mice have a reduced number of very small eumelanosomes in pigmented tissue with a concomitant decrease in the expression levels of melanosomal proteins (e.g., tyrosinase; see the record for ghost). The light coat color of draco1 mice suggests a reduced function of the OCA2 protein in these animals.

Primers PCR Primer
draco1(F):5'- AAGGTTCTTTAGGTTTCGTAAATCAGTCACA -3'
draco1(R):5'- CAGTTTTCTTTAGACTTCAGTCCCAGCA -3'

Sequencing Primer
draco1_seq(F):5'- TTCGTAAATCAGTCACAGTGGG -3'
draco1_seq(R):5'- cccagagaccccagacc -3'
Genotyping

Draco1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.

 

PCR Primers

Draco1(F): 5’- AAGGTTCTTTAGGTTTCGTAAATCAGTCACA- 3’

Draco1(R): 5’- CAGTTTTCTTTAGACTTCAGTCCCAGCA- 3’

 


Sequencing Primer

Draco1_seq(F): 5’- TTCGTAAATCAGTCACAGTGGG -3’


 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 983 nucleotides (from Genbank genomic region  NC_000073 for linear DNA sequence of Oca2) is amplified:

 

183429         aa ggttctttag gtttcgtaaa tcagtcacag tgggtggctc ttataatttt

183481 ctatggcgtg tgtccataat actcgtttct tccacagatt cctgtactcc tgaacctgag

183541 ccaagaccct gaaattagtt tgcctgcact gcctctcatg tatgccctgg ccctcggtgc

183601 ctgcctggga ggtaagggtt gccgactgca ttttgggaga ccacactaac ctcgttgtct

183661 agacaaagca agatttagta gttaacagat caaaagtaaa ttgaggagaa tcctggagac

183721 ttcctgattt caaaatctga acaaccagaa ctcctcagtt cctctgtgaa gcctctcctt

183781 ttggtcataa cctttcatgg attgggtccc agaaccctaa tcacggctac ccagggaaat

183841 gaagaaatgg aaaaaccatg gacatacagg aaaattggga tcatgtggtc tggggtctct

183901 gggaagctca gagtttatta tatgcagttg aacagggagg tgaggttatt tcatacatct

183961 gaccaagaag acaggcttag ctaatctctg taggagcggt ctctgtaggg gagcagtctt

184021 caggctgtaa acacacaggg gggggggggg ggaagctata acagacatct gctttacaca

184081 ctgtctccac tcacacccag atcagaggaa ggctttgcta cagcaacaat atagtcactc

184141 aggatttcac tttctcccta tttctcactc tacttctcac tctgcagaac ccatgatctg

184201 atgacagtca ctgttaatag ttcaaagcta atgcattccc accctgtcca agtaaggctc

184261 tgcaatggac attctttctc attctcctct ctgggctccc ctgttcagaa ggaatgcaca

184321 tgcattaggt agagcaggga ctctatcgca aaggaagagg gatggtaaga gatcaagcac

184381 aggtgctggg actgaagtct aaagaaaact g

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsTiana Purrington