Phenotypic Mutation 'Finlay' (pdf version)
AlleleFinlay
Mutation Type nonsense
Chromosome3
Coordinate135,595,053 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Nfkb1
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonym(s) p50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
Chromosomal Location 135,584,655-135,691,547 bp (-)
MGI Phenotype Strain: 1857225
Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible to both bacterial infections and hearing loss.
Accession Number

NCBI RefSeq: NM_008689; MGI:97312

Mapped Yes 
Amino Acid Change Leucine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000029812] [ENSMUSP00000128345]
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: L584*

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: L584*

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
kookaburra UTSW 3 135626611 nonsense
puff UTSW 3 135595053 nonsense
Roomba UTSW 3 135612412 critical splice donor site
JAX1:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
JAX1:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2261:Nfkb1 UTSW 3 135655608 splice acceptor site noncoding transcript
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4472:Nfkb1 UTSW 3 135615420 missense silent
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5219:Nfkb1 UTSW 3 135603736 missense silent
R5262:Nfkb1 UTSW 3 135612412 missense probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5678:Nfkb1 UTSW 3 135603736 missense silent
R5679:Nfkb1 UTSW 3 135603736 missense silent
R5680:Nfkb1 UTSW 3 135603736 missense silent
R5801:Nfkb1 UTSW 3 135595037 missense silent
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice
MMRRC Submission 037624-MU
Last Updated 09/12/2017 11:58 AM by Diantha La Vine
Record Created 07/03/2013 10:51 PM by Kuan-Wen Wang
Record Posted 01/13/2015
Phenotypic Description

Figure 1. Finlay mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Finlay phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0047, some of which exhibited a diminished T-dependent IgG response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of diminished T-dependent IgG responses to rSFV-β-gal using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 100 mutations (X-axis) identified in the G1 male of pedigree R0143.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. The diminished T-dependent IgG response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Nfkb1: T to A transversion at base pair 135,595,053 (v38) on chromosome 3, corresponding to base pair 96,495 in the GenBank genomic region NC_000069 encoding Nfkb1. Linkage was found with an additive model of inheritance (P = 5.795 x 10-5 ), wherein 6 affected variant homozygotes departed phenotypically from 10 homozygous reference mice and 14 heterozygous mice (Figure 2). The mutation corresponds to residue 2,253 in the NM_008689 mRNA sequence in exon of 18 of 25 total exons as well as residue 1,765 in the ENSMUST00000164430 cDNA sequence in exon 16 of 23 total exons.

 

96480 TATCAGACACCTCTGCACTTGGCCGTGATCACCAAGCAG   

578   -Y--Q--T--P--L--H--L--A--V--I--T--K--Q-

 

Genomic sequence and numbering corresponds to NC_000069. The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to a premature stop codon (*) substitution at residue 584 of the nuclear factor (NF)-κB1 protein.

Protein Prediction

Figure 3. Domain structures of the proteins encoded by Nfkb1. Nfkb1 encodes the p105 precursor protein that has a Rel-homology domain (RHD), glycine-rich region (GRR), seven ankyrin repeats within the ankyrin repeat domain (ARD), a death domain (DD), and a PEST sequence. The p50 subunit is generated upon processing of the p105 precursor protein. Nfkb1 can also encode IκBγ via an internal ATG; the IκBγ protein has the features of the p105 C-terminus. The Finlay mutation codes a premature stop codon at amino acid 594 within the p105 precursor protein and amino acid 220 in the IκBγ protein encoded by Nfkb1.

NF-κB1 (alternatively, p50/p105) is a member of the NF-κB protein family that are characterized by an N-terminal Rel homology domain (RHD), a glycine rich region (GRR), an ankyrin repeat domain (ARD), a death domain (DD), and a PEST motif [Figure 3; reviewed in (1)]. The p105 precursor protein can be proteolytically processed to generate p50 (i.e., amino acids 1-430 of p105) by two mechanisms: (i) signal-mediated processing, which requires SCFβ-TrCP-mediated polyubiquitination and (ii) basal/signal-independent processing via monoubiquitination (2;3;4).  The p50 and p105 subunits are also generated co-translationally by the p26S proteasome in a ubiquitin-independent manner  [(4;5); reviewed in (1)]. The domains necessary for the processing of p105 are described in the following paragraphs. The functions of p50 and p105 are described in the “Background” section, below.

 

The RHD (amino acids 42-240, SMART) is comprised of the N-terminal domain, the dimerization domain (DimD), and a nuclear localization sequence that mediate DNA binding, nuclear localization, and subunit dimerization [reviewed in (1)]. The p50 RHD mediates co-translational dimerization with p105 and this dimerization is necessary for efficient p50 production (4;6). Phosphorylation of Ser337, within a protein kinase A (PKA) consensus site, is essential for DNA binding by the p50 subunit (7;8). Ser65, within the DNA recognition loop of p50, is proposed to function to stabilize the interaction between the p50 homodimer and DNA by maintaining the secondary structure of the loop (7). The structure of the RHD is required for the survival of p50 during proteasomal processing of p105 (9;10). Destabilization of the RHD by a small deletion (Δ302-310) or mutations (Y267D/Y269D) results in a failure to generate the p50 subunit (9).

 

The GRR (amino acids 400-475 (10); 370-392, UniProt) is essential for the constitutive processing of p105 to p50 as well as for stabilization of the p50 subunit (4;5;9). The GRR prevents unfolding of p105 and functions as a processing stop signal to prevent entry of the p105 RHD into the proteasome (4;5;9;11;12). The GRR may also promote the endoproteolytic cleavage of p105 by the proteasome to produce p50; the resulting C-terminal fragment would be subsequently degraded by the proteasome (12;13). A caveat to the proposed endoproteolytic cleavage function of the GRR is that C-terminal p105 fragments have not been detected. Cohen et al. described a processing inhibitory domain (PID; aa 474-544) downstream of the GRR and upstream of the ARD that functions to regulate the constitutive processing of p105 (14).

 

The ARD is at the C-terminus of p105 (amino acids 507-743, SMART) and has seven ankyrin motifs [reviewed in (1)]. Ankyrin repeats are found in many proteins involved in cell cycle control and differentiation (15). Studies have shown that these repeats facilitate the interaction between transcription factor subunits (16;17). The ARD of p105 shares high sequence homology to the ARD in IκBα, an inhibitor of NF-κB [reviewed in (1)].

 

The DD of p105 (aa 801-888, UniProt) is essential for IKK1 and IKK2-mediated phosphorylation of the p105 PEST motif by acting as a docking site for IKK (18;19). The PEST motif contains a conserved motif (Asp-Ser927-Gly-Val-Gly-Thr-Ser932) homologous to the IKK target sequence in IκBα [reviewed in (20)]. In response to TNFα stimulation, glycogen synthase kinase-3β (GSK-3β) phosphorylates Ser903 and Ser907 on p105, facilitating IKK-mediated phosphorylation of Ser927 and Ser932 within the PEST motif and the subsequent recruitment of the SCFβ-TrCP E3 ligase to amino acids 446-454 and 918-934 in human p105 (2;4;5;11;21-23). Studies have shown that production of p50 upon TNFα stimulation is also independent of SCFβ-TrCP (23), indicating that another E3 ligase is involved in p105 processing (4;24).

 

Alternative splicing within the C-terminal coding region of mouse Nfkb1 results in coding of alternative precursor isoforms of NF-κB1, designated as p84 and p98 (25). The p98 isoform does not have the 111 C-terminal amino acid residues of p105 (amino acids 861-918), but has a novel 35-aa C-terminus. In the p84 isoform, loss of amino acids 780-802 results in a frameshift and the generation of an isoform that does not have the C-terminal 190 amino acids of p105 (25). In Jurkat T-cells, the p98 isoform transactivated NF-κB-regulated promoters, while the p84 and p105 isoforms did not (25). All of the precursor isoforms dimerized with p50, p65, and c-Rel when coexpressed in vitro; the p84 isoform reduced transactivation of p50-p65 threefold, while the p98 isoform increased p50-p65 cotransactivation (25). In addition, the p50 isoforms were able to bind to NF-κB sites on DNA in vitro (25). Grumont et al. determined that the unique C-terminus of p98 promoted proteolytic processing and that the transcript encoding p84 could be induced in a cell-type-specific pattern by stimuli (25). The physiological roles of p84 and p98 are unknown. In addition to encoding p50, p105, p84, and p98, the Nfkb1 transcript can also encode multiple isoforms of IκBγ, a member of the IκB family (see the record for bumble), by alternative splicing in certain lymphoid tissues (26;27). The 70-kDa IκBγ protein incorporates the C-terminal half (amino acids 365-971) of the p105 protein including the GRR and the ankyrin repeats (27;28). IκBγ prevents sequence-specific DNA binding of the p50/p65 NF-κB heterodimer, the p50 homodimer, and c-Rel in vitro as well as the transactivation and nuclear translocation of c-Rel both in vitro and in vivo by interacting with the residues (Lys77, Lys78, and Lys80) that normally contact the DNA (27;29). Two additional isoforms of IκBγ are generated by alternative splicing: IκBγ-1 and IκBγ-2 (26).  IκBγ-1 lacks the 59 amino acids C-terminal to the last ankyrin repeat and has a novel 35 amino acid C-terminus; IκBγ-2 lacks the 190 C-terminal amino acids found in the p70 isoform (26)In vitro, all three IκBγ isoforms inhibited p50-p65-mediated transactivation, but the p70 isoform suppressed transactivation more than IκBγ-1 or IκBγ-2 (26). The IκBγ-1 and IκBγ-2 isoforms did not effectively inhibit p65 transactivation, but did reduce c-Rel transactivation (26).

 

The Finlay mutation results in coding of a premature stop codon at residue 584 in p105.  Amino acid 584 resides within the ARD, in ankyrin repeat three (SMART; UniProt notes the location within ankyrin repeat two). A premature stop codon would also encode a premature stop codon within the IκBγ isoform (L220*).

 

NF-κB1 (p50 and p105) can form homodimers or heterodimers with c-Rel, RelA (p65), NF-κB2 (p52 and its precursor p100; see the record for xander), or RelB (30). The p105 precursor can act as an inhibitor of NF-κB dimers through both a direct dimerization to the NF-κB polypeptides as well as through interactions with preformed dimers (31). After agonist stimulation, p105 is degraded, facilitating the release of associated Rel subunits (i.e., RelA, c-Rel, and p50) and the translocation of the Rel subunits from the cytoplasm into the nucleus; RelB is not retained in the cytoplasm by p105 (32-35). In contrast, other studies found that p105 retains p50 in the cytoplasm either by binding directly to p50 homodimers or to p50 monomers (36). The association of p105 with p50 negatively regulates the processing of p105 by interfering with the entry of p105 into the proteasome (37;38). In addition, p105 and IκBγ can associate with NF-κB dimers and prevent them from translocating to the nucleus (28). The crystal structure of the p50/RelB heterodimer bound to a κB DNA target has also been solved [PDB: 2V2T(39)]. This crystal structure contained amino acids 39-363 of the RHD of mouse p50 along with aa 67-400 of mouse RelB co-crystallized with a target 10-mer κB DNA (39). Moorthy et al. describe the heterodimer structure as similar to other NF-κB/DNA complexes in that p50 and RelB both contain N-terminal DNA binding domains and C-terminal dimerization domains (39). RelB has four critical specificity-determining residues (Arg117, Arg119, Tyr120, and Glu123) (39). The p50/RelB dimer interface has a central hydrophobic core; Tyr267 in p50 and Tyr300 in RelB located at the center are essential for dimerization (39). Post-translational modifications (e.g., phosphorylation and ubiquitination) control the formation of p50 homodimers (4). The p50 homodimer can bind to both nucleosomal DNA as well as naked DNA, facilitating the regulation of genes at sites of transcriptionally repressed chromatin as well as genes found in transcriptionally active chromatin (40). Depending on the cell type, the p50 homodimer can act as either a transcriptional activator or a repressor [reviewed in (20)]. For example, in the absence of p105, mRNA levels of GM-CSF (granulocyte–macrophage colony-stimulating factor), IL-2, M-CSF (macrophage colony-stimulating factor) and TNFβ are increased in thymocytes; in macrophages expression of GM-CSF, TNFα and IL-6 are reduced (36;41). The p50 homodimer typically binds DNA in unstimulated cells to repress NF-κB-dependent gene transcription (42). After stimulation, p50 homodimers can also function as transcriptional activators by an association of the homodimer with transcriptional co-activators. For example, in LPS-stimulated macrophages, TNFα gene transcription is inhibited by the p50 homodimer via BCL-3-mediated recruitment of HDAC-1 to the TNFα promoter (43). In addition, p50 homodimers preferentially bind to three NF-κB sites in the distal portion of the TNFα gene promoter to repress transcription (44). Several studies have described crystal structures of the p50 homodimer:  PDB: 1NFK (45), PDB: 1SVC (46), PDB: 1BFT (47), and PDB: 1OOA (48). All of the studies described the RHD structure as folding into two domains connected by a 10 residue linker (aa 238-247). The C-terminal domain was described as a β-sandwich structure that is shared by the immunoglobin superfamily and is known to be essential for dimer formation (45). The N-terminal domain (aa 43-244) has an α-helical segment that forms contacts with the minor groove of the target (46). Furthermore, Tyr267 was essential for homodimer formation: the hydroxyl group of Tyr267 makes hydrogen bonds with the backbone carbonyl of Val251 and the side-chain of Arg252 in the opposing p50 subunit (47).

Expression/Localization

In resting cells, NF-κB1 resides in the cytoplasm in an inactive form bound to an inhibitory protein [e.g., IκBγ, and other inhibitory κBs (IκBα and β)] (49). Upon stimulation, IκB is degraded by the proteasome, facilitating the translocation of NF-κB1 dimers into the nucleus [reviewed in (20)]. In most cell types, the levels of p105 and p50 are similar, due to constitutive processing of the p105 precursor (50).

 

The NF-κB1 and IκBγ isoforms exhibit distinct localizations. For example, the p98 isoform RNA is expressed in heart, lung, spleen, thymus, kidney and testis, while the p84 isoform RNA is expressed in the spleen, thymus, lung, and testis (25). Both the p98 and p84 proteins were localized in the nuclei of transfected cells (25). The IκBγ isoforms are predominantly expressed in lymphoid cells (27). However, the localization of the isoforms differ from each other: the p70 isoform of IκBγ is a cytoplasmic protein, IκBγ-1 is cytoplasmic and nuclear, and IκBγ-2 is predominantly nuclear (26).

 

NF-κB1 expression and/or function can be regulated by several factors including, but not limited to, those in Table 1Nfkb1, along with the other NF-κB/Rel family members, contain binding sites for NF-κB within their promoter regions, subsequently regulating their own synthesis; the upstream sequence of Nfkb1 has three known NF-κB/Rel binding sites (51-53). The promoter region of Nfkb1 also contains possible HIP1/E2F, Sp1, Ets-1, and Elf-1 binding sites (51;54).

 

Table 1. Factors that regulate NF-κB1

Associated Protein

Description

NF-κB1-associated function(s)

Refs

NF-κB/Rel family members

 

Regulation of Nfkb1 transcription

(51;54)

microRNA-9 (miRNA-9) and miRNA-210

Non-coding small RNA that binds to the 3’- untranslated region of mRNAs, subsequently leading to the degradation of the mRNA

Downregulation of Nfkb1 expression

(55;56)

GSK-3β (glycogen synthase kinase-3 beta)

Serine/threonine kinase

Stabilizes p105, preventing proteolytic processing;

GSK-3β-mediated phosphorylation  facilitates  subsequent ubiquitination of p105

(57)

DNA-PK (DNA-dependent protein kinase)

See the record for clover

Phosphorylates the p50 subunit at Ser20 to facilitate NF-κB-induced expression of VCAM-1, a protein that is necessary for the transmigration, accumulation of leukocytes, and cell-cell interactions at inflammatory sites

(58)

Mtpn/V1 (myotrophin)

Cardiac protein; increased expression occurs in the postnatal cerebellum and in failing human hearts

Promotes the formation of p50 homodimers and can convert preformed p50-p65 heterodimers into p50 or p65 homodimers in vitro

(59)

TPL-2 (mitogen-activated protein kinase kinase kinase 8)

See the record for Sluggish

Stimulates phosphorylation and subsequent degradation of p105; p50 production is not changed

(60-63)

Casper/c-flip (CASP8 and FADD-like apoptosis regulator)

Regulates death-receptor-induced apoptosis

Inhibits p105 proteolysis

(64)

LYL1 (lymphoblastomic leukemia 1)

Basic helix–loop–helix transcription factor associated with T-cell acute leukemia

Downregulates Nfkb1 expression

(65)

BCL-6 (B cell leukemia/lymphoma 6)

Transcriptional repressor required for germinal center development and Th1/Th2 differentiation

Binds to three sequence motifs in the 5′ regulatory region of Nfkb1 to negatively regulate Nfkb1 expression

(66)

BCL-3

Oncoprotein

Releases the p50 homodimer from the inactive p50-p105 complex without proteolytic processing; facilitates nuclear translocation of the p50 subunit

 

(67;68)

EPRAP (EP4-associated protein)

Prostaglandin E2 (PGE2) receptor EP4-associated protein (EPRAP); forms a complex with p50/p105 and EP4

Promotes p105 stability after proinflammatory stimulation, limiting macrophage activation

(69)

Arrestin-2 and GRK5 (G protein-coupled receptor kinase 5)

Regulate G protein-coupled receptor signaling

Binding of arrestin-2 to the C-terminal domain of p105 and GRK5-mediated phosphorylation of p105 negatively regulates LPS-stimulated ERK activation

(70)

Chk1 (checkpoint kinase 1)

Serine/threonine kinase; effector of the G2 DNA damage checkpoint

Associates with and phosphorylates p50 following in response to DNA damage, subsequently preventing NF-κB DNA binding

(71)

Background
Figure 4. The NF-κB and IκB families. The nuclear-κB family consists of five members: REL (c-Rel), RelA (p65), RelB, p105/p50 (NF-κB1), and p100/p52 (NF-κB2; see the record for xander).  They share a conserved N-terminal Rel-homology domain (RHD), which contains the dimerization, nuclear translocation, and DNA binding motifs. c-Rel, RelA, and RelB also have non-homologous C-terminal transactivation domains, and RelB contains an additional leucine zipper (shown in orange). These factors dimerized in various combinations to form NF-κB transcription factor complexes. The inhibitor of NF-κB (IκB) family contains the classical IκBs (IκBαIκBβ, and IκBε), the NF-κB precursors (p105 and p100), as well as B-cell lymphoma 3 (BCL-3), IκBζ, and IκBNS. These proteins are characterized by an ankyrin domain that contains five to seven ankyrin repeats and are able to bind to and inhibit the NF-κB RHDs. Exceptions are BCL-3 and IκBζ, which are able to bind p50 and p52 homodimers and induce transcription. Cleavage of p105 and p100 generates the p50 and p52 NF-κB, respectively. p105 also generates IκBγ (not shown).

There are five NF-κB proteins in mammals: NF-κB1, c-Rel, RelA (alternatively, p65), NF-κB2 (alternatively, p52/p100; see the record for xander) and RelB [Figure 4; reviewed in (20)]. A variety of stimuli (e.g., cytokines, ultraviolet irradiation, and viral products) activate NF-κB complexes and the translocation of the activated complexes to the nucleus. In the nucleus, NF-κB acts as a transcription factor that regulates the expression of genes encoding a variety of immune response genes including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(49;72); reviewed in (20)]. Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (73)] and incorrect immune cell development [reviewed in (74-76)].

 

Figure 5. Canonical and non-canonical NF-κB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor) signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). See the sothe page for a description of NF-κB signaling after B cell receptor stimulation (not shown here for simplicity). The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

In the canonical NF-κB signaling pathway, cytokines (e.g., IL-1 and TNFα) or bacterial products (e.g., LPS) facilitate IKK (inhibitory κB kinase) activation (Figure 5). IKKβ activation results in the phosphorylation and subsequent proteasomal-mediated degradation of IκBα.  Degradation of IκBα releases the p50:p65 NF-κB heterodimer to translocate to the nucleus. In a noncanonical NF-κB signaling pathway, CD40 and lymphotoxin activate IKKα through NF-κB inducing kinase (NIK). A third NF-κB signaling pathway involves homodimers of p50. Upon translocation into the nucleus, p50-containing NF-κB dimers can complex with BCL-3, an IκB-like protein (19). BCL-3 contains an ARD that other IκB proteins can use to bind and sequester NF-κB in an inactive form (35). BCL-3 in complex with p50 homodimers stimulates nuclear import of the dimer, facilitating an increased affinity for DNA and the subsequent activation of the transcription of NF-κB responsive genes such as the anti-inflammatory cytokine Il10 (19;68). The p50 subunit, when complexed with BCL-3, may also function in an oncogenic capacity (77). The p50 homodimers can also associate with histone deacetylase (HDAC)-1 when transcriptionally inactive (42). Upon stimulation, NF-κB dimers containing p65 displace the p50 homodimer that is complexed with HDAC-1, subsequently initiating gene transcription. Association of the p50 homodimer with HDAC-1 functions to inhibit the transcription of several pro-inflammatory genes (i.e., Ccl2Cxcl10Gmcsf, and Mmp13(78). Association of the p50 homodimer with the transcriptional co-activator CREB binding protein (CREBBP; alternatively, CBP) in LPS- or TLR agonist-stimulated macrophages leads to increased expression of Il10 (79). Please see the record for xander for additional details about NF-κB signaling.

 

NF-κB1 has several known functions:

  1. NF-κB1 homodimers and NF-κB1/c-Rel heterodimers regulate TLR-9-mediated plasmacytoid dendritic cell (DC) morphogenesis, activation, and survival (80). NF-κB1 maintains DCs in the resting state and negatively regulates the spontaneous production of TNFα in cytotoxic T lymphocytes (81).

  2. NF-κB1 regulates the MAPK pathway and is required for Th2 cell differentiation (82). NF-κB1 is required for optimal Th2 cytokine (e.g., IL-4, IL-5, and IL-13) expression by DCs following exposure to Schistosoma mansoni eggs, a Th2-inducing stimuli (82). In addition, bone marrow-derived DCs (BMDCs) from NF-κB1 knockout (Nfkb1-/-) mice did not promote OVA-specific Th2 cell differentiation (82). Antigen-pulsed Nfkb1-/- DCs failed to primer for Th2 cytokine responses with a concomitant reduction in MAPK phosphorylation after injection into wild-type hosts.

  3. NF-κB1 regulates cell cycle progression and apoptosis in B lymphocytes (83)Nfkb1-/- mice have an increased rate of mature B cell turnover and an increase in cultured B cell apoptosis (83).

  4. Nfkb1-/- mice exhibit changes in CD8+ T-cell selection leading to the development of conventional CD8+ thymocytes with memory T cell-like properties [e.g., CD8+ thymocytes expressed low levels of CD24, high levels of CD62L, and high levels of CD44; (84)]. Also, IKK-induced proteolysis of the p105 precursor is essential for optimal CD4+ T cell activation and proliferation after receptor stimulation (85).

  5. A molecular complex comprised of p50 and miRNA-146a functions to regulate mast cell homeostasis and survival (86). In mast cells from p50 knockout mice, (p50-/-), prosurvival factors Bcl-2 and A1 were increased, while proapoptotic factors such as Bax and miR-146a were reduced. In human and mouse primary T lymphocytes, the p50-miRNA-146a complex regulates T cell expansion and memory formation in response to T cell receptor engagement (86).

  6. NF-κB1 regulates the expression of CXCR5 by TFh cells as well as Th2 cytokines IL-4, and IL-13 during responses to alum-precipitated proteins (87).

  7. The p50/p65 heterodimer binds to a p50 binding site in the Ly49 (see the record for Unnatural) promoter, Pro1, to regulate Ly49 expression in immature natural killer (NK) cells (88). NF-κB-mediated expression of Ly49 is necessary for NK cell development.

  8. The p50 subunit regulates neutrophil recruitment in the lungs during LPS-induced inflammation (89).

  9. After carotid artery ligation, NF-κB1 regulates inflammatory gene expression (e.g., TNFα and IL-1β) and limits vessel hyperplasia during vascular healing (90).  In a mouse model of chronic liver disease, the p50 subunit represses expression of TNF-α and the recruitment of inflammatory cells (91).

  10. In addition to TPL2-stimulated phosphorylation of p105 (see Table 1), interaction of p105 with TPL-2 represses TPL-2-induced MAPK signaling in unstimulated cells; TPL-2 activation occurs following degradation of p105 by the proteasome (61). NF-κB1 negatively regulates LPS-induced IFN signaling in macrophages by stabilizing TPL-2, facilitating TLR-induced ERK activation (60;63;92).  Association of TPL-2 with NF-κB1 and c-Rel is essential for the survival of TLR4-activated B cells through TPL-2-mediated phosphorylation and degradation of the proapoptotic protein, Bim (93). ABIN-2 (A20-binding inhibitor of NF-κB-2) interacts with p105 and TPL-2 in un-stimulated bone marrow-derived macrophages to stabilize TPL-2 expression (94-96). ABIN-2 also binds to A20, an inhibitor NF-κB activation, possibly through by interfering with NF-κB upstream of the IKK complex (96).

  11. The p50 subunit interacts with EHMT1 (euchromatin histone methyltransferase 1) to facilitate the recruitment of EHMT1 to type I-interferon (IFN) response genes (97). Subsequent EHMT1-mediated H3K9 methylation of the IFN-responsive gene promoters results in reduction in the expression of these genes (97).

  12. The C/EBP proteins (i.e., C/EBPα, C/EBPβ, C/EBPα oncoproteins, NF-IL6) are basic helix–loop–helix transcription factors that also interact with the p50 subunit (98;99). C/EBPα and C/EBPα facilitate the removal of histone deacetylases from p50 homodimers, subsequently leading to the induction of NF-κB target genes. The interaction of p50 with the C/EBP proteins facilitates the activation of Bcl-2 and Flip, subsequently inhibiting apoptosis (100;101).  The p50 subunit also induces C/EBPα transcription to subsequently stimulate neutrophil production during acute inflammation (102).

 

Polymorphisms in NFKB1 and/or inappropriate activation of NF-κB1 have been linked to several pathologies including, but not limited to:  rheumatoid arthritis (103), septic shock (104),  glomerulonephritis (105), Crohn’s disease (106;107), atherosclerosis (108), systemic lupus erythematosus (109), cancer (110-113), and HIV (114). NF-κB1 is required for CD4+ T cell proliferation as well as Th1 cell responses against pathogens, such as the intracellular protozoan parasite, Leishmania major (115). Studies with Nfkb1-/- mice determined that NF-κB1 also functions in T cell-mediated immunity to Toxoplasma gondii, a parasite that leads to Toxoplasmic encephalitis and necrosis in the brain (116). The p50 subunit of NF-κB1 has been shown to function in a protective role in a chemical model of Huntington’s disease (117) as well as in neural degeneration and brain injury (118). In mice, the p50 subunit has also been shown to be protective against an agent of amebic colitis, Entamoeba histolytica (119).

 

Nfkb1-/- mice (Nfkb1tm1Bal; MGI1857225) on the B6;129P genetic background exhibit abnormal cochlear inner hair cell morphology, decreased cochlear nerve compound action potential, and increased susceptibility to age-related and noise-induced hearing loss (120) as well as defects in bone marrow-derived DC function after LPS stimulation, defects in peritoneal macrophage cytokine production after stimulation with IFN-γ and/or LPS, reduced levels of Th1 cytokines, increased levels of Th2 cytokines after treatment with anti-CD3 (with or without anti-CD28 antibodies) (121). In the 129P2/OlaHsd genetic background, the Nfkb1-/- mice have normal dendritic cell development and maturation (122), but a decreased number of marginal zone B cells (123)Nfkb1-/-  mice in the 129P2/OlaHsd * C57BL/6 genetic background are more resistant to encephalomyocarditis (EMC) virus infection, but are more susceptible to Staphylococcus pneumonia infection (124).  These mice also exhibit decreased B cell proliferation following LPS and sCD40L stimulation (124;125), defective IgG3, IgE, and IgA class switching (124;125), mild typhlocolitis [large intestine inflammation; (126)], decreased IL-6 secretion from macrophages following LPS stimulation, and decreased myeloid dendritic cell number in Peyer’s patches (127)Nfkb1-/- mice in an undetermined genetic background had increased protection from CD4+ T cell-dependent acute inflammatory arthritis and peritonitis; CD4+ T cells from these mice exhibited increased apoptosis and reduced GM-CSF production (128). Another Nfkb1-/- knockout model (Nfkb1tm1Brv; MGI: 2179707; 129S1/Sv and 129S1/Sv * C57BL/6 genetic backgrounds) exhibits premature death (survival at 100 days is 50%), decreased numbers of CD4and CD8+ T cells in the spleen and lymph node, decreased T cell proliferation following stimulation with anti-CD3 (with or without anti-CD28 antibodies), decreased IgG3 levels after stimulation with LPS, increased IgE and IgG1 levels after stimulation with NP-KLH, increased B cell proliferation following low levels of stimulation, enlarged spleen due to extramedullary hematopoiesis and follicular expansion, enlarged lymph nodes, decreased IL-2, IL-4, and TNF-α secretion upon T cell stimulation, decreased osteoclast number and mild to moderate perivascular and periportal inflammation (36;129).

Putative Mechanism

T-cell mediated activation of B cells is required for extra-follicular and follicular responses to alum-precipitated proteins that are often used in vaccine formulations (87). Alum-precipitated OVA (alumOVA) stimulates follicular helper T (TFh) cells in germinal centers as well as the subsequent induction of B cells to differentiate into plasma cells, memory B cells, or centroblasts (87).  OVA-specific CD4+ T cells develop into Th2 cells that can subsequently induce extrafollicular plasmablasts. NF-κB1-deficient CD4+ T cells primed with alum-precipitated protein were unable to upregulate Th2-cytokines IL-4 and IL-13 (87).  In addition, Nfkb1-/- TFh cells have impaired CXCR5 expression, leading to reduced germinal center responses (87).  The loss of a T-dependent IgG response to rSFV-β-gal indicates that the Finlay mutation results in loss of functional p50/p105. However, other immune cell defects were not noted in Finlay indicating that the mutant protein may retain some function.

Primers PCR Primer
Finlay(F):5'- CAAATGCCAAGCCCTTATGCTGC -3'
Finlay(R):5'- CCCGACTGTTGAATGCTGGTTCTC -3'

Sequencing Primer
Finlay_seq(F):5'- AGCAAGGCGACTGCTCTTAC -3'
Finlay_seq(R):5'- AATGCTGGTTCTCTCCGTG -3'
Genotyping

Finlay genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

PCR Primers

Finlay(F): 5’-CCCGACTGTTGAATGCTGGTTCTC -3’

Finlay(R): 5’-CAAATGCCAAGCCCTTATGCTGC-3’

 

Sequencing Primer

Finlay_seq(R): 5’- AGCAAGGCGACTGCTCTTAC-3’


 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 434 nucleotides (from GenBank genomic region NC_000069 for the linear DNA sequence of Nfkb1) is amplified:

 

96315                cccgac tgttgaatgc tggttctctc cgtgggcctt tgagcctggc

96361 atgcagaaca ggaagctcct tgagtgacaa atgtccctac agtatgactc cataacgtag

96421 cctgaagcca ggggctacag acatccctaa gcaatggctc tccctctcct tctctgtgta

96481 gacacctctg cacttggccg tgatcaccaa gcaggaagat gtagtagagg atttgctgag

96541 ggttggggct gacctgagcc ttctggaccg ctggggcaac tctgtcctgc acctagctgc

96601 caaagaagga cacgacagaa tcctcagcat cctgctcaag agcagaaaag cagcgcccct

96661 tatcgaccac cccaatgggg aaggtaagag cagtcgcctt gctggctaac cgtcccctct

96721 cggctgcagc ataagggctt ggcatttg

 

Sense strand shown. Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is in red (T>A, sense strand; A>T, Chr. + strand).

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler