Phenotypic Mutation 'Finlay' (pdf version)
Allele | Finlay |
Mutation Type |
nonsense
|
Chromosome | 3 |
Coordinate | 135,300,814 bp (GRCm39) |
Base Change | A ⇒ T (forward strand) |
Gene |
Nfkb1
|
Gene Name | nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 |
Synonym(s) | p50, p50/p105, NF-kappaB, nuclear factor kappaB p50, NF kappaB1, p50 subunit of NF kappaB, NF-kappaB p50 |
Chromosomal Location |
135,290,416-135,397,308 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016] PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_008689; MGI:97312
|
Mapped | Yes |
Amino Acid Change |
Leucine changed to Stop codon
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000029812]
[ENSMUSP00000128345]
[ENSMUSP00000143601]
|
AlphaFold |
P25799 |
SMART Domains |
Protein: ENSMUSP00000029812 Gene: ENSMUSG00000028163 AA Change: L584*
Domain | Start | End | E-Value | Type |
Pfam:RHD
|
42 |
240 |
2.9e-75 |
PFAM |
IPT
|
247 |
348 |
1.14e-22 |
SMART |
low complexity region
|
368 |
414 |
N/A |
INTRINSIC |
ANK
|
538 |
568 |
2.27e1 |
SMART |
ANK
|
577 |
606 |
1.11e-2 |
SMART |
ANK
|
610 |
640 |
2.47e0 |
SMART |
ANK
|
646 |
675 |
5.53e-3 |
SMART |
ANK
|
680 |
710 |
1.9e-1 |
SMART |
ANK
|
714 |
743 |
2.18e-1 |
SMART |
DEATH
|
801 |
888 |
1.9e-19 |
SMART |
low complexity region
|
890 |
902 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000114798 Gene: ENSMUSG00000028163 AA Change: L223*
Domain | Start | End | E-Value | Type |
low complexity region
|
8 |
54 |
N/A |
INTRINSIC |
Blast:IPT
|
55 |
156 |
4e-22 |
BLAST |
ANK
|
178 |
208 |
2.27e1 |
SMART |
ANK
|
217 |
246 |
1.11e-2 |
SMART |
ANK
|
250 |
280 |
2.47e0 |
SMART |
ANK
|
286 |
315 |
5.53e-3 |
SMART |
ANK
|
320 |
350 |
1.9e-1 |
SMART |
ANK
|
354 |
383 |
2.18e-1 |
SMART |
Blast:DEATH
|
441 |
505 |
1e-34 |
BLAST |
PDB:2DBF|A
|
442 |
505 |
5e-32 |
PDB |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000128345 Gene: ENSMUSG00000028163 AA Change: L584*
Domain | Start | End | E-Value | Type |
Pfam:RHD_DNA_bind
|
42 |
240 |
2.9e-75 |
PFAM |
IPT
|
247 |
348 |
1.14e-22 |
SMART |
low complexity region
|
368 |
414 |
N/A |
INTRINSIC |
ANK
|
538 |
568 |
2.27e1 |
SMART |
ANK
|
577 |
606 |
1.11e-2 |
SMART |
ANK
|
610 |
640 |
2.47e0 |
SMART |
ANK
|
646 |
675 |
5.53e-3 |
SMART |
ANK
|
680 |
710 |
1.9e-1 |
SMART |
ANK
|
714 |
743 |
2.18e-1 |
SMART |
DEATH
|
801 |
888 |
1.9e-19 |
SMART |
low complexity region
|
890 |
902 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000143601 Gene: ENSMUSG00000028163
Domain | Start | End | E-Value | Type |
Pfam:RHD_DNA_bind
|
42 |
90 |
2.5e-19 |
PFAM |
|
Predicted Effect |
probably benign
|
Meta Mutation Damage Score |
0.9755 |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All alleles(79) : Targeted(5) Gene trapped(74)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01293:Nfkb1
|
APN |
3 |
135296600 |
missense |
probably damaging |
1.00 |
IGL01345:Nfkb1
|
APN |
3 |
135300742 |
missense |
probably damaging |
1.00 |
IGL01629:Nfkb1
|
APN |
3 |
135307228 |
missense |
probably benign |
|
IGL02216:Nfkb1
|
APN |
3 |
135300724 |
missense |
probably damaging |
0.98 |
IGL02273:Nfkb1
|
APN |
3 |
135310968 |
missense |
probably benign |
0.01 |
IGL02508:Nfkb1
|
APN |
3 |
135296579 |
missense |
probably damaging |
0.99 |
IGL03095:Nfkb1
|
APN |
3 |
135324591 |
missense |
possibly damaging |
0.48 |
Conversely
|
UTSW |
3 |
135332420 |
missense |
probably damaging |
1.00 |
Frisbee
|
UTSW |
3 |
135319704 |
missense |
possibly damaging |
0.93 |
Honeyeater
|
UTSW |
3 |
135297312 |
splice site |
probably benign |
|
kookaburra
|
UTSW |
3 |
135332372 |
nonsense |
probably null |
|
Murgatroyd
|
UTSW |
3 |
135332471 |
missense |
possibly damaging |
0.72 |
Poderoso
|
UTSW |
3 |
135319751 |
missense |
probably damaging |
1.00 |
Puff
|
UTSW |
3 |
135300814 |
nonsense |
probably null |
|
Roomba
|
UTSW |
3 |
135318173 |
critical splice donor site |
probably null |
|
Wheelo
|
UTSW |
3 |
135321110 |
missense |
possibly damaging |
0.81 |
R0026:Nfkb1
|
UTSW |
3 |
135297334 |
missense |
probably damaging |
1.00 |
R0047:Nfkb1
|
UTSW |
3 |
135300814 |
nonsense |
probably null |
|
R0989:Nfkb1
|
UTSW |
3 |
135295157 |
missense |
probably benign |
0.00 |
R1210:Nfkb1
|
UTSW |
3 |
135300688 |
missense |
probably benign |
0.03 |
R1661:Nfkb1
|
UTSW |
3 |
135300718 |
missense |
probably damaging |
1.00 |
R1665:Nfkb1
|
UTSW |
3 |
135300718 |
missense |
probably damaging |
1.00 |
R1725:Nfkb1
|
UTSW |
3 |
135373519 |
missense |
probably damaging |
1.00 |
R1984:Nfkb1
|
UTSW |
3 |
135321110 |
missense |
possibly damaging |
0.81 |
R1985:Nfkb1
|
UTSW |
3 |
135321110 |
missense |
possibly damaging |
0.81 |
R2154:Nfkb1
|
UTSW |
3 |
135307240 |
missense |
probably benign |
0.44 |
R2281:Nfkb1
|
UTSW |
3 |
135307282 |
missense |
probably damaging |
1.00 |
R2409:Nfkb1
|
UTSW |
3 |
135319704 |
missense |
possibly damaging |
0.93 |
R2504:Nfkb1
|
UTSW |
3 |
135295090 |
missense |
possibly damaging |
0.51 |
R4032:Nfkb1
|
UTSW |
3 |
135300110 |
missense |
possibly damaging |
0.63 |
R4232:Nfkb1
|
UTSW |
3 |
135309531 |
missense |
probably damaging |
1.00 |
R4936:Nfkb1
|
UTSW |
3 |
135319743 |
missense |
probably damaging |
0.97 |
R5085:Nfkb1
|
UTSW |
3 |
135309568 |
missense |
probably benign |
0.36 |
R5262:Nfkb1
|
UTSW |
3 |
135318173 |
critical splice donor site |
probably null |
|
R5384:Nfkb1
|
UTSW |
3 |
135318303 |
missense |
possibly damaging |
0.95 |
R5385:Nfkb1
|
UTSW |
3 |
135318303 |
missense |
possibly damaging |
0.95 |
R5434:Nfkb1
|
UTSW |
3 |
135332372 |
nonsense |
probably null |
|
R5663:Nfkb1
|
UTSW |
3 |
135309612 |
missense |
possibly damaging |
0.88 |
R5865:Nfkb1
|
UTSW |
3 |
135309541 |
missense |
probably damaging |
1.00 |
R6006:Nfkb1
|
UTSW |
3 |
135309522 |
nonsense |
probably null |
|
R6013:Nfkb1
|
UTSW |
3 |
135332445 |
missense |
possibly damaging |
0.86 |
R6234:Nfkb1
|
UTSW |
3 |
135332471 |
missense |
possibly damaging |
0.72 |
R6785:Nfkb1
|
UTSW |
3 |
135321064 |
missense |
probably benign |
|
R7175:Nfkb1
|
UTSW |
3 |
135319751 |
missense |
probably damaging |
1.00 |
R7227:Nfkb1
|
UTSW |
3 |
135332420 |
missense |
probably damaging |
1.00 |
R7394:Nfkb1
|
UTSW |
3 |
135319458 |
missense |
possibly damaging |
0.54 |
R7727:Nfkb1
|
UTSW |
3 |
135291162 |
missense |
possibly damaging |
0.48 |
R7815:Nfkb1
|
UTSW |
3 |
135309552 |
missense |
probably damaging |
1.00 |
R7849:Nfkb1
|
UTSW |
3 |
135291173 |
missense |
|
|
R8004:Nfkb1
|
UTSW |
3 |
135297312 |
splice site |
probably benign |
|
R8059:Nfkb1
|
UTSW |
3 |
135299613 |
missense |
possibly damaging |
0.54 |
R8806:Nfkb1
|
UTSW |
3 |
135295213 |
missense |
probably damaging |
1.00 |
R9169:Nfkb1
|
UTSW |
3 |
135310874 |
missense |
probably benign |
0.00 |
X0050:Nfkb1
|
UTSW |
3 |
135312384 |
missense |
probably damaging |
1.00 |
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | Live Mice |
MMRRC Submission |
037624-MU
|
Last Updated |
2019-01-28 9:12 AM
by Diantha La Vine
|
Record Created |
2013-07-03 10:51 PM
by Kuan-Wen Wang
|
Record Posted |
2015-01-13 |
Phenotypic Description |
The Finlay phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0047, some of which exhibited a diminished T-dependent IgG response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. The diminished T-dependent IgG response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Nfkb1: T to A transversion at base pair 135,595,053 (v38) on chromosome 3, corresponding to base pair 96,495 in the GenBank genomic region NC_000069 encoding Nfkb1. Linkage was found with an additive model of inheritance (P = 5.795 x 10-5 ), wherein 6 affected variant homozygotes departed phenotypically from 10 homozygous reference mice and 14 heterozygous mice (Figure 2). The mutation corresponds to residue 2,253 in the NM_008689 mRNA sequence in exon of 18 of 25 total exons as well as residue 1,765 in the ENSMUST00000164430 cDNA sequence in exon 16 of 23 total exons. 96480 TATCAGACACCTCTGCACTTGGCCGTGATCACCAAGCAG
578 -Y--Q--T--P--L--H--L--A--V--I--T--K--Q- Genomic sequence and numbering corresponds to NC_000069. The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to a premature stop codon (*) substitution at residue 584 of the nuclear factor (NF)-κB1 protein.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
NF-κB1 (alternatively, p50/p105) is a member of the NF-κB protein family that are characterized by an N-terminal Rel homology domain (RHD), a glycine rich region (GRR), an ankyrin repeat domain (ARD), a death domain (DD), and a PEST motif [Figure 3; reviewed in (1)]. The p105 precursor protein can be proteolytically processed to generate p50 (i.e., amino acids 1-430 of p105) by two mechanisms: (i) signal-mediated processing, which requires SCFβ-TrCP-mediated polyubiquitination and (ii) basal/signal-independent processing via monoubiquitination (2;3;4). The p50 and p105 subunits are also generated co-translationally by the p26S proteasome in a ubiquitin-independent manner [(4;5); reviewed in (1)]. The domains necessary for the processing of p105 are described in the following paragraphs. The functions of p50 and p105 are described in the “Background” section, below. The RHD (amino acids 42-240, SMART) is comprised of the N-terminal domain, the dimerization domain (DimD), and a nuclear localization sequence that mediate DNA binding, nuclear localization, and subunit dimerization [reviewed in (1)]. The p50 RHD mediates co-translational dimerization with p105 and this dimerization is necessary for efficient p50 production (4;6). Phosphorylation of Ser337, within a protein kinase A (PKA) consensus site, is essential for DNA binding by the p50 subunit (7;8). Ser65, within the DNA recognition loop of p50, is proposed to function to stabilize the interaction between the p50 homodimer and DNA by maintaining the secondary structure of the loop (7). The structure of the RHD is required for the survival of p50 during proteasomal processing of p105 (9;10). Destabilization of the RHD by a small deletion (Δ302-310) or mutations (Y267D/Y269D) results in a failure to generate the p50 subunit (9). The GRR (amino acids 400-475 (10); 370-392, UniProt) is essential for the constitutive processing of p105 to p50 as well as for stabilization of the p50 subunit (4;5;9). The GRR prevents unfolding of p105 and functions as a processing stop signal to prevent entry of the p105 RHD into the proteasome (4;5;9;11;12). The GRR may also promote the endoproteolytic cleavage of p105 by the proteasome to produce p50; the resulting C-terminal fragment would be subsequently degraded by the proteasome (12;13). A caveat to the proposed endoproteolytic cleavage function of the GRR is that C-terminal p105 fragments have not been detected. Cohen et al. described a processing inhibitory domain (PID; aa 474-544) downstream of the GRR and upstream of the ARD that functions to regulate the constitutive processing of p105 (14). The ARD is at the C-terminus of p105 (amino acids 507-743, SMART) and has seven ankyrin motifs [reviewed in (1)]. Ankyrin repeats are found in many proteins involved in cell cycle control and differentiation (15). Studies have shown that these repeats facilitate the interaction between transcription factor subunits (16;17). The ARD of p105 shares high sequence homology to the ARD in IκBα, an inhibitor of NF-κB [reviewed in (1)]. The DD of p105 (aa 801-888, UniProt) is essential for IKK1 and IKK2-mediated phosphorylation of the p105 PEST motif by acting as a docking site for IKK (18;19). The PEST motif contains a conserved motif (Asp-Ser927-Gly-Val-Gly-Thr-Ser932) homologous to the IKK target sequence in IκBα [reviewed in (20)]. In response to TNFα stimulation, glycogen synthase kinase-3β (GSK-3β) phosphorylates Ser903 and Ser907 on p105, facilitating IKK-mediated phosphorylation of Ser927 and Ser932 within the PEST motif and the subsequent recruitment of the SCFβ-TrCP E3 ligase to amino acids 446-454 and 918-934 in human p105 (2;4;5;11;21-23). Studies have shown that production of p50 upon TNFα stimulation is also independent of SCFβ-TrCP (23), indicating that another E3 ligase is involved in p105 processing (4;24). Alternative splicing within the C-terminal coding region of mouse Nfkb1 results in coding of alternative precursor isoforms of NF-κB1, designated as p84 and p98 (25). The p98 isoform does not have the 111 C-terminal amino acid residues of p105 (amino acids 861-918), but has a novel 35-aa C-terminus. In the p84 isoform, loss of amino acids 780-802 results in a frameshift and the generation of an isoform that does not have the C-terminal 190 amino acids of p105 (25). In Jurkat T-cells, the p98 isoform transactivated NF-κB-regulated promoters, while the p84 and p105 isoforms did not (25). All of the precursor isoforms dimerized with p50, p65, and c-Rel when coexpressed in vitro; the p84 isoform reduced transactivation of p50-p65 threefold, while the p98 isoform increased p50-p65 cotransactivation (25). In addition, the p50 isoforms were able to bind to NF-κB sites on DNA in vitro (25). Grumont et al. determined that the unique C-terminus of p98 promoted proteolytic processing and that the transcript encoding p84 could be induced in a cell-type-specific pattern by stimuli (25). The physiological roles of p84 and p98 are unknown. In addition to encoding p50, p105, p84, and p98, the Nfkb1 transcript can also encode multiple isoforms of IκBγ, a member of the IκB family (see the record for bumble), by alternative splicing in certain lymphoid tissues (26;27). The 70-kDa IκBγ protein incorporates the C-terminal half (amino acids 365-971) of the p105 protein including the GRR and the ankyrin repeats (27;28). IκBγ prevents sequence-specific DNA binding of the p50/p65 NF-κB heterodimer, the p50 homodimer, and c-Rel in vitro as well as the transactivation and nuclear translocation of c-Rel both in vitro and in vivo by interacting with the residues (Lys77, Lys78, and Lys80) that normally contact the DNA (27;29). Two additional isoforms of IκBγ are generated by alternative splicing: IκBγ-1 and IκBγ-2 (26). IκBγ-1 lacks the 59 amino acids C-terminal to the last ankyrin repeat and has a novel 35 amino acid C-terminus; IκBγ-2 lacks the 190 C-terminal amino acids found in the p70 isoform (26). In vitro, all three IκBγ isoforms inhibited p50-p65-mediated transactivation, but the p70 isoform suppressed transactivation more than IκBγ-1 or IκBγ-2 (26). The IκBγ-1 and IκBγ-2 isoforms did not effectively inhibit p65 transactivation, but did reduce c-Rel transactivation (26). The Finlay mutation results in coding of a premature stop codon at residue 584 in p105. Amino acid 584 resides within the ARD, in ankyrin repeat three (SMART; UniProt notes the location within ankyrin repeat two). A premature stop codon would also encode a premature stop codon within the IκBγ isoform (L220*). NF-κB1 (p50 and p105) can form homodimers or heterodimers with c-Rel, RelA (p65), NF-κB2 (p52 and its precursor p100; see the record for xander), or RelB (30). The p105 precursor can act as an inhibitor of NF-κB dimers through both a direct dimerization to the NF-κB polypeptides as well as through interactions with preformed dimers (31). After agonist stimulation, p105 is degraded, facilitating the release of associated Rel subunits (i.e., RelA, c-Rel, and p50) and the translocation of the Rel subunits from the cytoplasm into the nucleus; RelB is not retained in the cytoplasm by p105 (32-35). In contrast, other studies found that p105 retains p50 in the cytoplasm either by binding directly to p50 homodimers or to p50 monomers (36). The association of p105 with p50 negatively regulates the processing of p105 by interfering with the entry of p105 into the proteasome (37;38). In addition, p105 and IκBγ can associate with NF-κB dimers and prevent them from translocating to the nucleus (28). The crystal structure of the p50/RelB heterodimer bound to a κB DNA target has also been solved [PDB: 2V2T; (39)]. This crystal structure contained amino acids 39-363 of the RHD of mouse p50 along with aa 67-400 of mouse RelB co-crystallized with a target 10-mer κB DNA (39). Moorthy et al. describe the heterodimer structure as similar to other NF-κB/DNA complexes in that p50 and RelB both contain N-terminal DNA binding domains and C-terminal dimerization domains (39). RelB has four critical specificity-determining residues (Arg117, Arg119, Tyr120, and Glu123) (39). The p50/RelB dimer interface has a central hydrophobic core; Tyr267 in p50 and Tyr300 in RelB located at the center are essential for dimerization (39). Post-translational modifications (e.g., phosphorylation and ubiquitination) control the formation of p50 homodimers (4). The p50 homodimer can bind to both nucleosomal DNA as well as naked DNA, facilitating the regulation of genes at sites of transcriptionally repressed chromatin as well as genes found in transcriptionally active chromatin (40). Depending on the cell type, the p50 homodimer can act as either a transcriptional activator or a repressor [reviewed in (20)]. For example, in the absence of p105, mRNA levels of GM-CSF (granulocyte–macrophage colony-stimulating factor), IL-2, M-CSF (macrophage colony-stimulating factor) and TNFβ are increased in thymocytes; in macrophages expression of GM-CSF, TNFα and IL-6 are reduced (36;41). The p50 homodimer typically binds DNA in unstimulated cells to repress NF-κB-dependent gene transcription (42). After stimulation, p50 homodimers can also function as transcriptional activators by an association of the homodimer with transcriptional co-activators. For example, in LPS-stimulated macrophages, TNFα gene transcription is inhibited by the p50 homodimer via BCL-3-mediated recruitment of HDAC-1 to the TNFα promoter (43). In addition, p50 homodimers preferentially bind to three NF-κB sites in the distal portion of the TNFα gene promoter to repress transcription (44). Several studies have described crystal structures of the p50 homodimer: PDB: 1NFK (45), PDB: 1SVC (46), PDB: 1BFT (47), and PDB: 1OOA (48). All of the studies described the RHD structure as folding into two domains connected by a 10 residue linker (aa 238-247). The C-terminal domain was described as a β-sandwich structure that is shared by the immunoglobin superfamily and is known to be essential for dimer formation (45). The N-terminal domain (aa 43-244) has an α-helical segment that forms contacts with the minor groove of the target (46). Furthermore, Tyr267 was essential for homodimer formation: the hydroxyl group of Tyr267 makes hydrogen bonds with the backbone carbonyl of Val251 and the side-chain of Arg252 in the opposing p50 subunit (47).
|
Expression/Localization | In resting cells, NF-κB1 resides in the cytoplasm in an inactive form bound to an inhibitory protein [e.g., IκBγ, and other inhibitory κBs (IκBα and β)] (49). Upon stimulation, IκB is degraded by the proteasome, facilitating the translocation of NF-κB1 dimers into the nucleus [reviewed in (20)]. In most cell types, the levels of p105 and p50 are similar, due to constitutive processing of the p105 precursor (50). The NF-κB1 and IκBγ isoforms exhibit distinct localizations. For example, the p98 isoform RNA is expressed in heart, lung, spleen, thymus, kidney and testis, while the p84 isoform RNA is expressed in the spleen, thymus, lung, and testis (25). Both the p98 and p84 proteins were localized in the nuclei of transfected cells (25). The IκBγ isoforms are predominantly expressed in lymphoid cells (27). However, the localization of the isoforms differ from each other: the p70 isoform of IκBγ is a cytoplasmic protein, IκBγ-1 is cytoplasmic and nuclear, and IκBγ-2 is predominantly nuclear (26). NF-κB1 expression and/or function can be regulated by several factors including, but not limited to, those in Table 1. Nfkb1, along with the other NF-κB/Rel family members, contain binding sites for NF-κB within their promoter regions, subsequently regulating their own synthesis; the upstream sequence of Nfkb1 has three known NF-κB/Rel binding sites (51-53). The promoter region of Nfkb1 also contains possible HIP1/E2F, Sp1, Ets-1, and Elf-1 binding sites (51;54). Table 1. Factors that regulate NF-κB1
Associated Protein
|
Description
|
NF-κB1-associated function(s)
|
Refs
|
NF-κB/Rel family members
|
|
Regulation of Nfkb1 transcription
|
(51;54)
|
microRNA-9 (miRNA-9) and miRNA-210
|
Non-coding small RNA that binds to the 3’- untranslated region of mRNAs, subsequently leading to the degradation of the mRNA
|
Downregulation of Nfkb1 expression
|
(55;56)
|
GSK-3β (glycogen synthase kinase-3 beta)
|
Serine/threonine kinase
|
Stabilizes p105, preventing proteolytic processing;
GSK-3β-mediated phosphorylation facilitates subsequent ubiquitination of p105
|
(57)
|
DNA-PK (DNA-dependent protein kinase)
|
See the record for clover
|
Phosphorylates the p50 subunit at Ser20 to facilitate NF-κB-induced expression of VCAM-1, a protein that is necessary for the transmigration, accumulation of leukocytes, and cell-cell interactions at inflammatory sites
|
(58)
|
Mtpn/V1 (myotrophin)
|
Cardiac protein; increased expression occurs in the postnatal cerebellum and in failing human hearts
|
Promotes the formation of p50 homodimers and can convert preformed p50-p65 heterodimers into p50 or p65 homodimers in vitro
|
(59)
|
TPL-2 (mitogen-activated protein kinase kinase kinase 8)
|
See the record for Sluggish
|
Stimulates phosphorylation and subsequent degradation of p105; p50 production is not changed
|
(60-63)
|
Casper/c-flip (CASP8 and FADD-like apoptosis regulator)
|
Regulates death-receptor-induced apoptosis
|
Inhibits p105 proteolysis
|
(64)
|
LYL1 (lymphoblastomic leukemia 1)
|
Basic helix–loop–helix transcription factor associated with T-cell acute leukemia
|
Downregulates Nfkb1 expression
|
(65)
|
BCL-6 (B cell leukemia/lymphoma 6)
|
Transcriptional repressor required for germinal center development and Th1/Th2 differentiation
|
Binds to three sequence motifs in the 5′ regulatory region of Nfkb1 to negatively regulate Nfkb1 expression
|
(66)
|
BCL-3
|
Oncoprotein
|
Releases the p50 homodimer from the inactive p50-p105 complex without proteolytic processing; facilitates nuclear translocation of the p50 subunit |
(67;68)
|
EPRAP (EP4-associated protein)
|
Prostaglandin E2 (PGE2) receptor EP4-associated protein (EPRAP); forms a complex with p50/p105 and EP4
|
Promotes p105 stability after proinflammatory stimulation, limiting macrophage activation
|
(69)
|
Arrestin-2 and GRK5 (G protein-coupled receptor kinase 5)
|
Regulate G protein-coupled receptor signaling
|
Binding of arrestin-2 to the C-terminal domain of p105 and GRK5-mediated phosphorylation of p105 negatively regulates LPS-stimulated ERK activation
|
(70)
|
Chk1 (checkpoint kinase 1)
|
Serine/threonine kinase; effector of the G2 DNA damage checkpoint
|
Associates with and phosphorylates p50 following in response to DNA damage, subsequently preventing NF-κB DNA binding
|
(71)
|
|
Background |
There are five NF-κB proteins in mammals: NF-κB1, c-Rel, RelA (alternatively, p65), NF-κB2 (alternatively, p52/p100; see the record for xander) and RelB [Figure 4; reviewed in (20)]. A variety of stimuli (e.g., cytokines, ultraviolet irradiation, and viral products) activate NF-κB complexes and the translocation of the activated complexes to the nucleus. In the nucleus, NF-κB acts as a transcription factor that regulates the expression of genes encoding a variety of immune response genes including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(49;72); reviewed in (20)]. Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (73)] and incorrect immune cell development [reviewed in (74-76)].
In the canonical NF-κB signaling pathway, cytokines (e.g., IL-1 and TNFα) or bacterial products (e.g., LPS) facilitate IKK (inhibitory κB kinase) activation (Figure 5). IKKβ activation results in the phosphorylation and subsequent proteasomal-mediated degradation of IκBα. Degradation of IκBα releases the p50:p65 NF-κB heterodimer to translocate to the nucleus. In a noncanonical NF-κB signaling pathway, CD40 and lymphotoxin activate IKKα through NF-κB inducing kinase (NIK). A third NF-κB signaling pathway involves homodimers of p50. Upon translocation into the nucleus, p50-containing NF-κB dimers can complex with BCL-3, an IκB-like protein (19). BCL-3 contains an ARD that other IκB proteins can use to bind and sequester NF-κB in an inactive form (35). BCL-3 in complex with p50 homodimers stimulates nuclear import of the dimer, facilitating an increased affinity for DNA and the subsequent activation of the transcription of NF-κB responsive genes such as the anti-inflammatory cytokine Il10 (19;68). The p50 subunit, when complexed with BCL-3, may also function in an oncogenic capacity (77). The p50 homodimers can also associate with histone deacetylase (HDAC)-1 when transcriptionally inactive (42). Upon stimulation, NF-κB dimers containing p65 displace the p50 homodimer that is complexed with HDAC-1, subsequently initiating gene transcription. Association of the p50 homodimer with HDAC-1 functions to inhibit the transcription of several pro-inflammatory genes (i.e., Ccl2, Cxcl10, Gmcsf, and Mmp13) (78). Association of the p50 homodimer with the transcriptional co-activator CREB binding protein (CREBBP; alternatively, CBP) in LPS- or TLR agonist-stimulated macrophages leads to increased expression of Il10 (79). Please see the record for xander for additional details about NF-κB signaling. NF-κB1 has several known functions:
-
NF-κB1 homodimers and NF-κB1/c-Rel heterodimers regulate TLR-9-mediated plasmacytoid dendritic cell (DC) morphogenesis, activation, and survival (80). NF-κB1 maintains DCs in the resting state and negatively regulates the spontaneous production of TNFα in cytotoxic T lymphocytes (81).
-
NF-κB1 regulates the MAPK pathway and is required for Th2 cell differentiation (82). NF-κB1 is required for optimal Th2 cytokine (e.g., IL-4, IL-5, and IL-13) expression by DCs following exposure to Schistosoma mansoni eggs, a Th2-inducing stimuli (82). In addition, bone marrow-derived DCs (BMDCs) from NF-κB1 knockout (Nfkb1-/-) mice did not promote OVA-specific Th2 cell differentiation (82). Antigen-pulsed Nfkb1-/- DCs failed to primer for Th2 cytokine responses with a concomitant reduction in MAPK phosphorylation after injection into wild-type hosts.
-
NF-κB1 regulates cell cycle progression and apoptosis in B lymphocytes (83). Nfkb1-/- mice have an increased rate of mature B cell turnover and an increase in cultured B cell apoptosis (83).
-
Nfkb1-/- mice exhibit changes in CD8+ T-cell selection leading to the development of conventional CD8+ thymocytes with memory T cell-like properties [e.g., CD8+ thymocytes expressed low levels of CD24, high levels of CD62L, and high levels of CD44; (84)]. Also, IKK-induced proteolysis of the p105 precursor is essential for optimal CD4+ T cell activation and proliferation after receptor stimulation (85).
-
A molecular complex comprised of p50 and miRNA-146a functions to regulate mast cell homeostasis and survival (86). In mast cells from p50 knockout mice, (p50-/-), prosurvival factors Bcl-2 and A1 were increased, while proapoptotic factors such as Bax and miR-146a were reduced. In human and mouse primary T lymphocytes, the p50-miRNA-146a complex regulates T cell expansion and memory formation in response to T cell receptor engagement (86).
-
NF-κB1 regulates the expression of CXCR5 by TFh cells as well as Th2 cytokines IL-4, and IL-13 during responses to alum-precipitated proteins (87).
-
The p50/p65 heterodimer binds to a p50 binding site in the Ly49 (see the record for Unnatural) promoter, Pro1, to regulate Ly49 expression in immature natural killer (NK) cells (88). NF-κB-mediated expression of Ly49 is necessary for NK cell development.
-
The p50 subunit regulates neutrophil recruitment in the lungs during LPS-induced inflammation (89).
-
After carotid artery ligation, NF-κB1 regulates inflammatory gene expression (e.g., TNFα and IL-1β) and limits vessel hyperplasia during vascular healing (90). In a mouse model of chronic liver disease, the p50 subunit represses expression of TNF-α and the recruitment of inflammatory cells (91).
-
In addition to TPL2-stimulated phosphorylation of p105 (see Table 1), interaction of p105 with TPL-2 represses TPL-2-induced MAPK signaling in unstimulated cells; TPL-2 activation occurs following degradation of p105 by the proteasome (61). NF-κB1 negatively regulates LPS-induced IFN signaling in macrophages by stabilizing TPL-2, facilitating TLR-induced ERK activation (60;63;92). Association of TPL-2 with NF-κB1 and c-Rel is essential for the survival of TLR4-activated B cells through TPL-2-mediated phosphorylation and degradation of the proapoptotic protein, Bim (93). ABIN-2 (A20-binding inhibitor of NF-κB-2) interacts with p105 and TPL-2 in un-stimulated bone marrow-derived macrophages to stabilize TPL-2 expression (94-96). ABIN-2 also binds to A20, an inhibitor NF-κB activation, possibly through by interfering with NF-κB upstream of the IKK complex (96).
-
The p50 subunit interacts with EHMT1 (euchromatin histone methyltransferase 1) to facilitate the recruitment of EHMT1 to type I-interferon (IFN) response genes (97). Subsequent EHMT1-mediated H3K9 methylation of the IFN-responsive gene promoters results in reduction in the expression of these genes (97).
-
The C/EBP proteins (i.e., C/EBPα, C/EBPβ, C/EBPα oncoproteins, NF-IL6) are basic helix–loop–helix transcription factors that also interact with the p50 subunit (98;99). C/EBPα and C/EBPα facilitate the removal of histone deacetylases from p50 homodimers, subsequently leading to the induction of NF-κB target genes. The interaction of p50 with the C/EBP proteins facilitates the activation of Bcl-2 and Flip, subsequently inhibiting apoptosis (100;101). The p50 subunit also induces C/EBPα transcription to subsequently stimulate neutrophil production during acute inflammation (102).
Polymorphisms in NFKB1 and/or inappropriate activation of NF-κB1 have been linked to several pathologies including, but not limited to: rheumatoid arthritis (103), septic shock (104), glomerulonephritis (105), Crohn’s disease (106;107), atherosclerosis (108), systemic lupus erythematosus (109), cancer (110-113), and HIV (114). NF-κB1 is required for CD4+ T cell proliferation as well as Th1 cell responses against pathogens, such as the intracellular protozoan parasite, Leishmania major (115). Studies with Nfkb1-/- mice determined that NF-κB1 also functions in T cell-mediated immunity to Toxoplasma gondii, a parasite that leads to Toxoplasmic encephalitis and necrosis in the brain (116). The p50 subunit of NF-κB1 has been shown to function in a protective role in a chemical model of Huntington’s disease (117) as well as in neural degeneration and brain injury (118). In mice, the p50 subunit has also been shown to be protective against an agent of amebic colitis, Entamoeba histolytica (119). Nfkb1-/- mice (Nfkb1tm1Bal; MGI: 1857225) on the B6;129P genetic background exhibit abnormal cochlear inner hair cell morphology, decreased cochlear nerve compound action potential, and increased susceptibility to age-related and noise-induced hearing loss (120) as well as defects in bone marrow-derived DC function after LPS stimulation, defects in peritoneal macrophage cytokine production after stimulation with IFN-γ and/or LPS, reduced levels of Th1 cytokines, increased levels of Th2 cytokines after treatment with anti-CD3 (with or without anti-CD28 antibodies) (121). In the 129P2/OlaHsd genetic background, the Nfkb1-/- mice have normal dendritic cell development and maturation (122), but a decreased number of marginal zone B cells (123). Nfkb1-/- mice in the 129P2/OlaHsd * C57BL/6 genetic background are more resistant to encephalomyocarditis (EMC) virus infection, but are more susceptible to Staphylococcus pneumonia infection (124). These mice also exhibit decreased B cell proliferation following LPS and sCD40L stimulation (124;125), defective IgG3, IgE, and IgA class switching (124;125), mild typhlocolitis [large intestine inflammation; (126)], decreased IL-6 secretion from macrophages following LPS stimulation, and decreased myeloid dendritic cell number in Peyer’s patches (127). Nfkb1-/- mice in an undetermined genetic background had increased protection from CD4+ T cell-dependent acute inflammatory arthritis and peritonitis; CD4+ T cells from these mice exhibited increased apoptosis and reduced GM-CSF production (128). Another Nfkb1-/- knockout model (Nfkb1tm1Brv; MGI: 2179707; 129S1/Sv and 129S1/Sv * C57BL/6 genetic backgrounds) exhibits premature death (survival at 100 days is 50%), decreased numbers of CD4+ and CD8+ T cells in the spleen and lymph node, decreased T cell proliferation following stimulation with anti-CD3 (with or without anti-CD28 antibodies), decreased IgG3 levels after stimulation with LPS, increased IgE and IgG1 levels after stimulation with NP-KLH, increased B cell proliferation following low levels of stimulation, enlarged spleen due to extramedullary hematopoiesis and follicular expansion, enlarged lymph nodes, decreased IL-2, IL-4, and TNF-α secretion upon T cell stimulation, decreased osteoclast number and mild to moderate perivascular and periportal inflammation (36;129).
|
Putative Mechanism | T-cell mediated activation of B cells is required for extra-follicular and follicular responses to alum-precipitated proteins that are often used in vaccine formulations (87). Alum-precipitated OVA (alumOVA) stimulates follicular helper T (TFh) cells in germinal centers as well as the subsequent induction of B cells to differentiate into plasma cells, memory B cells, or centroblasts (87). OVA-specific CD4+ T cells develop into Th2 cells that can subsequently induce extrafollicular plasmablasts. NF-κB1-deficient CD4+ T cells primed with alum-precipitated protein were unable to upregulate Th2-cytokines IL-4 and IL-13 (87). In addition, Nfkb1-/- TFh cells have impaired CXCR5 expression, leading to reduced germinal center responses (87). The loss of a T-dependent IgG response to rSFV-β-gal indicates that the Finlay mutation results in loss of functional p50/p105. However, other immune cell defects were not noted in Finlay indicating that the mutant protein may retain some function.
|
Primers |
PCR Primer
Finlay_pcr_F: CCCGACTGTTGAATGCTGGTTCTC
Finlay_pcr_R: CAAATGCCAAGCCCTTATGCTGC
|
Genotyping | Finlay genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing. PCR Primers
Finlay(F): 5’-CCCGACTGTTGAATGCTGGTTCTC -3’
Finlay(R): 5’-CAAATGCCAAGCCCTTATGCTGC-3’ Sequencing Primer
Finlay_seq(R): 5’- AGCAAGGCGACTGCTCTTAC-3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40X
6) 72°C 10:00
7) 4°C ∞ The following sequence of 434 nucleotides (from GenBank genomic region NC_000069 for the linear DNA sequence of Nfkb1) is amplified: 96315 cccgac tgttgaatgc tggttctctc cgtgggcctt tgagcctggc
96361 atgcagaaca ggaagctcct tgagtgacaa atgtccctac agtatgactc cataacgtag
96421 cctgaagcca ggggctacag acatccctaa gcaatggctc tccctctcct tctctgtgta
96481 gacacctctg cacttggccg tgatcaccaa gcaggaagat gtagtagagg atttgctgag
96541 ggttggggct gacctgagcc ttctggaccg ctggggcaac tctgtcctgc acctagctgc
96601 caaagaagga cacgacagaa tcctcagcat cctgctcaag agcagaaaag cagcgcccct
96661 tatcgaccac cccaatgggg aaggtaagag cagtcgcctt gctggctaac cgtcccctct
96721 cggctgcagc ataagggctt ggcatttg Sense strand shown. Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is in red (T>A, sense strand; A>T, Chr. + strand).
|
References |
5. Moorthy, A. K., Savinova, O. V., Ho, J. Q., Wang, V. Y., Vu, D., and Ghosh, G. (2006) The 20S Proteasome Processes NF-kappaB1 p105 into p50 in a Translation-Independent Manner. EMBO J. 25, 1945-1956.
9. Lee, C., Schwartz, M. P., Prakash, S., Iwakura, M., and Matouschek, A. (2001) ATP-Dependent Proteases Degrade their Substrates by Processively Unraveling them from the Degradation Signal. Mol Cell. 7, 627-637.
11. Orian, A., Schwartz, A. L., Israel, A., Whiteside, S., Kahana, C., and Ciechanover, A. (1999) Structural Motifs Involved in Ubiquitin-Mediated Processing of the NF-kappaB Precursor p105: Roles of the Glycine-Rich Region and a Downstream Ubiquitination Domain. Mol Cell Biol. 19, 3664-3673.
16. LaMarco, K., Thompson, C. C., Byers, B. P., Walton, E. M., and McKnight, S. L. (1991) Identification of Ets- and Notch-Related Subunits in GA Binding Protein. Science. 253, 789-792.
21. Orian, A., Gonen, H., Bercovich, B., Fajerman, I., Eytan, E., Israel, A., Mercurio, F., Iwai, K., Schwartz, A. L., and Ciechanover, A. (2000) SCF(Beta)(-TrCP) Ubiquitin Ligase-Mediated Processing of NF-kappaB p105 Requires Phosphorylation of its C-Terminus by IkappaB Kinase. EMBO J. 19, 2580-2591.
22. Salmeron, A., Janzen, J., Soneji, Y., Bump, N., Kamens, J., Allen, H., and Ley, S. C. (2001) Direct Phosphorylation of NF-kappaB1 p105 by the IkappaB Kinase Complex on Serine 927 is Essential for Signal-Induced p105 Proteolysis. J Biol Chem. 276, 22215-22222.
23. Lang, V., Janzen, J., Fischer, G. Z., Soneji, Y., Beinke, S., Salmeron, A., Allen, H., Hay, R. T., Ben-Neriah, Y., and Ley, S. C. (2003) BetaTrCP-Mediated Proteolysis of NF-kappaB1 p105 Requires Phosphorylation of p105 Serines 927 and 932. Mol Cell Biol. 23, 402-413.
33. Solan, N. J., Miyoshi, H., Carmona, E. M., Bren, G. D., and Paya, C. V. (2002) RelB Cellular Regulation and Transcriptional Activity are Regulated by p100. J Biol Chem. 277, 1405-1418.
36. Ishikawa, H., Claudio, E., Dambach, D., Raventos-Suarez, C., Ryan, C., and Bravo, R. (1998) Chronic Inflammation and Susceptibility to Bacterial Infections in Mice Lacking the Polypeptide (p)105 Precursor (NF-kappaB1) but Expressing p50. J Exp Med. 187, 985-996.
39. Moorthy, A. K., Huang, D. B., Wang, V. Y., Vu, D., and Ghosh, G. (2007) X-Ray Structure of a NF-kappaB p50/RelB/DNA Complex Reveals Assembly of Multiple Dimers on Tandem kappaB Sites. J Mol Biol. 373, 723-734.
40. Angelov, D., Lenouvel, F., Hans, F., Muller, C. W., Bouvet, P., Bednar, J., Moudrianakis, E. N., Cadet, J., and Dimitrov, S. (2004) The Histone Octamer is Invisible when NF-kappaB Binds to the Nucleosome. J Biol Chem. 279, 42374-42382.
43. Wessells, J., Baer, M., Young, H. A., Claudio, E., Brown, K., Siebenlist, U., and Johnson, P. F. (2004) BCL-3 and NF-kappaB p50 Attenuate Lipopolysaccharide-Induced Inflammatory Responses in Macrophages. J Biol Chem. 279, 49995-50003.
44. Baer, M., Dillner, A., Schwartz, R. C., Sedon, C., Nedospasov, S., and Johnson, P. F. (1998) Tumor Necrosis Factor Alpha Transcription in Macrophages is Attenuated by an Autocrine Factor that Preferentially Induces NF-kappaB p50. Mol Cell Biol. 18, 5678-5689.
46. Muller, C. W., Rey, F. A., Sodeoka, M., Verdine, G. L., and Harrison, S. C. (1995) Structure of the NF-Kappa B p50 Homodimer Bound to DNA. Nature. 373, 311-317.
48. Huang, D. B., Vu, D., Cassiday, L. A., Zimmerman, J. M., Maher, L. J.,3rd, and Ghosh, G. (2003) Crystal Structure of NF-kappaB (p50)2 Complexed to a High-Affinity RNA Aptamer. Proc Natl Acad Sci U S A. 100, 9268-9273.
54. Ten, R. M., Paya, C. V., Israel, N., Le Bail, O., Mattei, M. G., Virelizier, J. L., Kourilsky, P., and Israel, A. (1992) The Characterization of the Promoter of the Gene Encoding the p50 Subunit of NF-Kappa B Indicates that it Participates in its Own Regulation. EMBO J. 11, 195-203.
55. Guo, L. M., Pu, Y., Han, Z., Liu, T., Li, Y. X., Liu, M., Li, X., and Tang, H. (2009) MicroRNA-9 Inhibits Ovarian Cancer Cell Growth through Regulation of NF-kappaB1. FEBS J. 276, 5537-5546.
56. Qi, J., Qiao, Y., Wang, P., Li, S., Zhao, W., and Gao, C. (2012) MicroRNA-210 Negatively Regulates LPS-Induced Production of Proinflammatory Cytokines by Targeting NF-kappaB1 in Murine Macrophages. FEBS Lett. 586, 1201-1207.
58. Ju, J., Naura, A. S., Errami, Y., Zerfaoui, M., Kim, H., Kim, J. G., Abd Elmageed, Z. Y., Abdel-Mageed, A. B., Giardina, C., Beg, A. A., Smulson, M. E., and Boulares, A. H. (2010) Phosphorylation of p50 NF-kappaB at a Single Serine Residue by DNA-Dependent Protein Kinase is Critical for VCAM-1 Expression upon TNF Treatment. J Biol Chem. 285, 41152-41160.
59. Knuefermann, P., Chen, P., Misra, A., Shi, S. P., Abdellatif, M., and Sivasubramanian, N. (2002) Myotrophin/V-1, a Protein Up-Regulated in the Failing Human Heart and in Postnatal Cerebellum, Converts NFkappa B p50-p65 Heterodimers to p50-p50 and p65-p65 Homodimers. J Biol Chem. 277, 23888-23897.
61. Beinke, S., Deka, J., Lang, V., Belich, M. P., Walker, P. A., Howell, S., Smerdon, S. J., Gamblin, S. J., and Ley, S. C. (2003) NF-kappaB1 p105 Negatively Regulates TPL-2 MEK Kinase Activity. Mol Cell Biol. 23, 4739-4752.
65. Ferrier, R., Nougarede, R., Doucet, S., Kahn-Perles, B., Imbert, J., and Mathieu-Mahul, D. (1999) Physical Interaction of the bHLH LYL1 Protein and NF-kappaB1 p105. Oncogene. 18, 995-1005.
66. Li, Z., Wang, X., Yu, R. Y., Ding, B. B., Yu, J. J., Dai, X. M., Naganuma, A., Stanley, E. R., and Ye, B. H. (2005) BCL-6 Negatively Regulates Expression of the NF-kappaB1 p105/p50 Subunit. J Immunol. 174, 205-214.
69. Minami, M., Shimizu, K., Okamoto, Y., Folco, E., Ilasaca, M. L., Feinberg, M. W., Aikawa, M., and Libby, P. (2008) Prostaglandin E Receptor Type 4-Associated Protein Interacts Directly with NF-kappaB1 and Attenuates Macrophage Activation. J Biol Chem. 283, 9692-9703.
70. Parameswaran, N., Pao, C. S., Leonhard, K. S., Kang, D. S., Kratz, M., Ley, S. C., and Benovic, J. L. (2006) Arrestin-2 and G Protein-Coupled Receptor Kinase 5 Interact with NFkappaB1 p105 and Negatively Regulate Lipopolysaccharide-Stimulated ERK1/2 Activation in Macrophages. J Biol Chem. 281, 34159-34170.
71. Schmitt, A. M., Crawley, C. D., Kang, S., Raleigh, D. R., Yu, X., Wahlstrom, J. S., Voce, D. J., Darga, T. E., Weichselbaum, R. R., and Yamini, B. (2011) P50 (NF-kappaB1) is an Effector Protein in the Cytotoxic Response to DNA Methylation Damage. Mol Cell. 44, 785-796.
78. Elsharkawy, A. M., Oakley, F., Lin, F., Packham, G., Mann, D. A., and Mann, J. (2010) The NF-kappaB p50:P50:HDAC-1 Repressor Complex Orchestrates Transcriptional Inhibition of Multiple Pro-Inflammatory Genes. J Hepatol. 53, 519-527.
80. O'Keeffe, M., Grumont, R. J., Hochrein, H., Fuchsberger, M., Gugasyan, R., Vremec, D., Shortman, K., and Gerondakis, S. (2005) Distinct Roles for the NF-kappaB1 and c-Rel Transcription Factors in the Differentiation and Survival of Plasmacytoid and Conventional Dendritic Cells Activated by TLR-9 Signals. Blood. 106, 3457-3464.
81. Dissanayake, D., Hall, H., Berg-Brown, N., Elford, A. R., Hamilton, S. R., Murakami, K., Deluca, L. S., Gommerman, J. L., and Ohashi, P. S. (2011) Nuclear Factor-kappaB1 Controls the Functional Maturation of Dendritic Cells and Prevents the Activation of Autoreactive T Cells. Nat Med. 17, 1663-1667.
82. Artis, D., Kane, C. M., Fiore, J., Zaph, C., Shapira, S., Joyce, K., Macdonald, A., Hunter, C., Scott, P., and Pearce, E. J. (2005) Dendritic Cell-Intrinsic Expression of NF-Kappa B1 is Required to Promote Optimal Th2 Cell Differentiation. J Immunol. 174, 7154-7159.
83. Grumont, R. J., Rourke, I. J., O'Reilly, L. A., Strasser, A., Miyake, K., Sha, W., and Gerondakis, S. (1998) B Lymphocytes Differentially use the Rel and Nuclear Factor kappaB1 (NF-kappaB1) Transcription Factors to Regulate Cell Cycle Progression and Apoptosis in Quiescent and Mitogen-Activated Cells. J Exp Med. 187, 663-674.
84. Gugasyan, R., Horat, E., Kinkel, S. A., Ross, F., Grigoriadis, G., Gray, D., O'Keeffe, M., Berzins, S. P., Belz, G. T., Grumont, R. J., Banerjee, A., Strasser, A., Godfrey, D. I., Tsichlis, P. N., and Gerondakis, S. (2011) The NF-kappaB1 Transcription Factor Prevents the Intrathymic Development of CD8 T Cells with Memory Properties. EMBO J. 31, 692-706.
85. Sriskantharajah, S., Belich, M. P., Papoutsopoulou, S., Janzen, J., Tybulewicz, V., Seddon, B., and Ley, S. C. (2009) Proteolysis of NF-kappaB1 p105 is Essential for T Cell Antigen Receptor-Induced Proliferation. Nat Immunol. 10, 38-47.
86. Rusca, N., Deho, L., Montagner, S., Zielinski, C. E., Sica, A., Sallusto, F., and Monticelli, S. (2012) MiR-146a and NF-kappaB1 Regulate Mast Cell Survival and T Lymphocyte Differentiation. Mol Cell Biol. 32, 4432-4444.
87. Serre, K., Mohr, E., Benezech, C., Bird, R., Khan, M., Caamano, J. H., Cunningham, A. F., and Maclennan, I. C. (2011) Selective Effects of NF-kappaB1 Deficiency in CD4(+) T Cells on Th2 and TFh Induction by Alum-Precipitated Protein Vaccines. Eur J Immunol. 41, 1573-1582.
88. Pascal, V., Nathan, N. R., Claudio, E., Siebenlist, U., and Anderson, S. K. (2007) NF-Kappa B p50/p65 Affects the Frequency of Ly49 Gene Expression by NK Cells. J Immunol. 179, 1751-1759.
90. Ruusalepp, A., Yan, Z. Q., Carlsen, H., Czibik, G., Hansson, G. K., Moskaug, J. O., Blomhoff, R., and Valen, G. (2006) Gene Deletion of NF-kappaB p105 Enhances Neointima Formation in a Mouse Model of Carotid Artery Injury. Cardiovasc Drugs Ther. 20, 103-111.
91. Oakley, F., Mann, J., Nailard, S., Smart, D. E., Mungalsingh, N., Constandinou, C., Ali, S., Wilson, S. J., Millward-Sadler, H., Iredale, J. P., and Mann, D. A. (2005) Nuclear Factor-kappaB1 (p50) Limits the Inflammatory and Fibrogenic Responses to Chronic Injury. Am J Pathol. 166, 695-708.
92. Yang, H. T., Wang, Y., Zhao, X., Demissie, E., Papoutsopoulou, S., Mambole, A., O'Garra, A., Tomczak, M. F., Erdman, S. E., Fox, J. G., Ley, S. C., and Horwitz, B. H. (2011) NF-kappaB1 Inhibits TLR-Induced IFN-Beta Production in Macrophages through TPL-2-Dependent ERK Activation. J Immunol. 186, 1989-1996.
93. Banerjee, A., Grumont, R., Gugasyan, R., White, C., Strasser, A., and Gerondakis, S. (2008) NF-kappaB1 and c-Rel Cooperate to Promote the Survival of TLR4-Activated B Cells by Neutralizing Bim Via Distinct Mechanisms. Blood. 112, 5063-5073.
94. Lang, V., Symons, A., Watton, S. J., Janzen, J., Soneji, Y., Beinke, S., Howell, S., and Ley, S. C. (2004) ABIN-2 Forms a Ternary Complex with TPL-2 and NF-Kappa B1 p105 and is Essential for TPL-2 Protein Stability. Mol Cell Biol. 24, 5235-5248.
95. Bouwmeester, T., Bauch, A., Ruffner, H., Angrand, P. O., Bergamini, G., Croughton, K., Cruciat, C., Eberhard, D., Gagneur, J., Ghidelli, S., Hopf, C., Huhse, B., Mangano, R., Michon, A. M., Schirle, M., Schlegl, J., Schwab, M., Stein, M. A., Bauer, A., Casari, G., Drewes, G., Gavin, A. C., Jackson, D. B., Joberty, G., Neubauer, G., Rick, J., Kuster, B., and Superti-Furga, G. (2004) A Physical and Functional Map of the Human TNF-alpha/NF-Kappa B Signal Transduction Pathway. Nat Cell Biol. 6, 97-105.
96. Van Huffel, S., Delaei, F., Heyninck, K., De Valck, D., and Beyaert, R. (2001) Identification of a Novel A20-Binding Inhibitor of Nuclear Factor-Kappa B Activation Termed ABIN-2. J Biol Chem. 276, 30216-30223.
98. Dooher, J. E., Paz-Priel, I., Houng, S., Baldwin, A. S.,Jr, and Friedman, A. D. (2011) C/EBPalpha, C/EBPalpha Oncoproteins, Or C/EBPbeta Preferentially Bind NF-kappaB p50 Compared with p65, Focusing Therapeutic Targeting on the C/EBP:P50 Interaction. Mol Cancer Res. 9, 1395-1405.
100. Paz-Priel, I., Cai, D. H., Wang, D., Kowalski, J., Blackford, A., Liu, H., Heckman, C. A., Gombart, A. F., Koeffler, H. P., Boxer, L. M., and Friedman, A. D. (2005) CCAAT/enhancer Binding Protein Alpha (C/EBPalpha) and C/EBPalpha Myeloid Oncoproteins Induce Bcl-2 Via Interaction of their Basic Regions with Nuclear Factor-kappaB p50. Mol Cancer Res. 3, 585-596.
104. Adamzik, M., Schafer, S., Frey, U. H., Becker, A., Kreuzer, M., Winning, S., Frede, S., Steinmann, J., Fandrey, J., Zacharowski, K., Siffert, W., Peters, J., and Hartmann, M. (2013) The NFKB1 Promoter Polymorphism (-94ins/delATTG) Alters Nuclear Translocation of NF-kappaB1 in Monocytes After Lipopolysaccharide Stimulation and is Associated with Increased Mortality in Sepsis. Anesthesiology. 118, 123-133.
105. Panzer, U., Steinmetz, O. M., Turner, J. E., Meyer-Schwesinger, C., von Ruffer, C., Meyer, T. N., Zahner, G., Gomez-Guerrero, C., Schmid, R. M., Helmchen, U., Moeckel, G. W., Wolf, G., Stahl, R. A., and Thaiss, F. (2009) Resolution of Renal Inflammation: A New Role for NF-kappaB1 (p50) in Inflammatory Kidney Diseases. Am J Physiol Renal Physiol. 297, F429-39.
106. Borm, M. E., van Bodegraven, A. A., Mulder, C. J., Kraal, G., and Bouma, G. (2005) A NFKB1 Promoter Polymorphism is Involved in Susceptibility to Ulcerative Colitis. Int J Immunogenet. 32, 401-405.
107. Hayashi, R., Tahara, T., Yamaaki, T., Saito, T., Matsunaga, K., Hayashi, N., Fukumura, A., Ozaki, K., Nakamura, M., Shiroeda, H., Tsutsumi, M., Shibata, T., and Arisawa, T. (2012) -449 C>G Polymorphism of NFKB1 Gene, Coding Nuclear Factor-Kappa-B, is Associated with the Susceptibility to Ulcerative Colitis. World J Gastroenterol. 18, 6981-6986.
108. Kanters, E., Gijbels, M. J., van der Made, I., Vergouwe, M. N., Heeringa, P., Kraal, G., Hofker, M. H., and de Winther, M. P. (2004) Hematopoietic NF-kappaB1 Deficiency Results in Small Atherosclerotic Lesions with an Inflammatory Phenotype. Blood. 103, 934-940.
110. Liptay, S., Schmid, R. M., Perkins, N. D., Meltzer, P., Altherr, M. R., McPherson, J. D., Wasmuth, J. J., and Nabel, G. J. (1992) Related Subunits of NF-Kappa B Map to Two Distinct Loci Associated with Translocations in Leukemia, NFKB1 and NFKB2. Genomics. 13, 287-292.
112. Bours, V., Dejardin, E., Goujon-Letawe, F., Merville, M. P., and Castronovo, V. (1994) The NF-Kappa B Transcription Factor and Cancer: High Expression of NF-Kappa B- and I Kappa B-Related Proteins in Tumor Cell Lines. Biochem Pharmacol. 47, 145-149.
113. Cai, H., Sun, L., Cui, L., Cao, Q., Qin, C., Zhang, G., Mao, X., Wang, M., Zhang, Z., Shao, P., and Yin, C. (2012) A Functional Insertion/Deletion Polymorphism (-94 ins/del ATTG) in the Promoter Region of the NFKB1 Gene is Related to the Risk of Renal Cell Carcinoma. Urol Int. .
114. Della Chiara, G., Crotti, A., Liboi, E., Giacca, M., Poli, G., and Lusic, M. (2011) Negative Regulation of HIV-1 Transcription by a Heterodimeric NF-kappaB1/p50 and C-Terminally Truncated STAT5 Complex. J Mol Biol. 410, 933-943.
115. Artis, D., Speirs, K., Joyce, K., Goldschmidt, M., Caamano, J., Hunter, C. A., and Scott, P. (2003) NF-Kappa B1 is Required for Optimal CD4+ Th1 Cell Development and Resistance to Leishmania Major. J Immunol. 170, 1995-2003.
116. Harris, T. H., Wilson, E. H., Tait, E. D., Buckley, M., Shapira, S., Caamano, J., Artis, D., and Hunter, C. A. (2010) NF-kappaB1 Contributes to T Cell-Mediated Control of Toxoplasma Gondii in the CNS. J Neuroimmunol. 222, 19-28.
120. Lang, H., Schulte, B. A., Zhou, D., Smythe, N., Spicer, S. S., and Schmiedt, R. A. (2006) Nuclear Factor kappaB Deficiency is Associated with Auditory Nerve Degeneration and Increased Noise-Induced Hearing Loss. J Neurosci. 26, 3541-3550.
121. Lamhamedi-Cherradi, S. E., Zheng, S., Hilliard, B. A., Xu, L., Sun, J., Alsheadat, S., Liou, H. C., and Chen, Y. H. (2003) Transcriptional Regulation of Type I Diabetes by NF-Kappa B. J Immunol. 171, 4886-4892.
122. Ouaaz, F., Arron, J., Zheng, Y., Choi, Y., and Beg, A. A. (2002) Dendritic Cell Development and Survival Require Distinct NF-kappaB Subunits. Immunity. 16, 257-270.
125. Snapper, C. M., Zelazowski, P., Rosas, F. R., Kehry, M. R., Tian, M., Baltimore, D., and Sha, W. C. (1996) B Cells from p50/NF-Kappa B Knockout Mice have Selective Defects in Proliferation, Differentiation, Germ-Line CH Transcription, and Ig Class Switching. J Immunol. 156, 183-191.
126. Erdman, S., Fox, J. G., Dangler, C. A., Feldman, D., and Horwitz, B. H. (2001) Typhlocolitis in NF-Kappa B-Deficient Mice. J Immunol. 166, 1443-1447.
127. Paxian, S., Merkle, H., Riemann, M., Wilda, M., Adler, G., Hameister, H., Liptay, S., Pfeffer, K., and Schmid, R. M. (2002) Abnormal Organogenesis of Peyer's Patches in Mice Deficient for NF-kappaB1, NF-kappaB2, and Bcl-3. Gastroenterology. 122, 1853-1868.
128. Campbell, I. K., van Nieuwenhuijze, A., Segura, E., O'Donnell, K., Coghill, E., Hommel, M., Gerondakis, S., Villadangos, J. A., and Wicks, I. P. (2011) Differentiation of Inflammatory Dendritic Cells is Mediated by NF-kappaB1-Dependent GM-CSF Production in CD4 T Cells. J Immunol. 186, 5468-5477.
129. Iotsova, V., Caamano, J., Loy, J., Yang, Y., Lewin, A., and Bravo, R. (1997) Osteopetrosis in Mice Lacking NF-kappaB1 and NF-kappaB2. Nat Med. 3, 1285-1289.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine, Peter Jurek |
Authors | Kuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler |