Phenotypic Mutation 'serpens' (pdf version)
Alleleserpens
Mutation Type missense
Chromosome18
Coordinate5,772,455 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Zeb1
Gene Name zinc finger E-box binding homeobox 1
Synonym(s) 3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1
Chromosomal Location 5,591,860-5,775,467 bp (+)
MGI Phenotype Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations also exhibit extensive skeletal abnormalities. Homozygotes generally die at birth.
Accession Number

NCBI RefSeq: NM_011546; MGI:1344313

Mapped Yes 
Amino Acid Change Cysteine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025081] [ENSMUSP00000124677] [ENSMUSP00000135865]
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: C915S

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000025081)
SMART Domains Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 94 117 1.3e-5 SMART
ZnF_C2H2 124 146 1.3e-6 SMART
ZnF_C2H2 164 186 2e-6 SMART
ZnF_C2H2 192 212 7.8e-2 SMART
low complexity region 232 248 N/A INTRINSIC
low complexity region 476 499 N/A INTRINSIC
HOX 503 565 3.9e-5 SMART
low complexity region 674 686 N/A INTRINSIC
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Predicted Effect noncoding transcript
Phenotypic Category T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All mutations/alleles(15) : Chemically induced (ENU)(1) Gene trapped(7) Spontaneous(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5767774 missense probably benign 0.00
IGL01139:Zeb1 APN 18 5705061 missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5767906 missense probably damaging 1.00
IGL01444:Zeb1 APN 18 5767138 missense probably benign
IGL01806:Zeb1 APN 18 5767867 missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5759037 nonsense probably null
IGL02059:Zeb1 APN 18 5766892 missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5767150 missense probably benign 0.03
IGL03153:Zeb1 APN 18 5770511 missense probably damaging 1.00
cellophane UTSW 18 5770554 nonsense
N/A - 293:Zeb1 UTSW 18 5767076 missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5766808 missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5772455 missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5759123 nonsense probably null
R0646:Zeb1 UTSW 18 5759027 missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5767138 missense probably benign
R1251:Zeb1 UTSW 18 5705089 missense probably damaging 1.00
R1257:Zeb1 UTSW 18 5772699 missense possibly damaging 0.53
R1501:Zeb1 UTSW 18 5761399 missense possibly damaging 0.92
R1547:Zeb1 UTSW 18 5767450 missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5766298 nonsense probably null
R1815:Zeb1 UTSW 18 5767898 missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5766458 missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5767681 missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5772859 small insertion probably benign
R3888:Zeb1 UTSW 18 5748743 missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5767799 missense probably benign 0.06
R3952:Zeb1 UTSW 18 5772716 missense probably benign 0.17
R4271:Zeb1 UTSW 18 5758985 missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5766775 missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5767286 missense probably damaging 1.00
R5558:Zeb1 UTSW 18 5767227 missense silent
R5839:Zeb1 UTSW 18 5767507 missense probably benign
R5913:Zeb1 UTSW 18 5766765 missense possibly damaging 0.49
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038202-MU
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 07/06/2013 4:18 PM by Kuan-Wen Wang
Record Posted 06/05/2015
Phenotypic Description

Figure 1. Serpens mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The serpens phenotype was identified among G3 mice of the pedigree R0445, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of reduced response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R0488.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. The diminished T-dependent antibody response was linked by continuous variable mapping to a mutation in Zeb1:  a T to A transversion at base pair 5,772,455 (v38) on chromosome 18, or base pair 180,596 in the GenBank genomic region NC_000084. Linkage was found with a recessive model of inheritance, wherein 1 variant homozygote departed phenotypically from 5 homozygous reference mice and 10 heterozygous mice with a P value of 8.436 x 10-6 (Figure 2).  

 

The mutation corresponds to residue 2,793 in the mRNA sequence NM_011546 within exon 8 of 8 total exons.

 

2778 CACGAGTGTGGAATCTGTAGAAAGGCATTTAAA

910  -H--E--C--G--I--C--R--K--A--F--K-

 

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to serine (S) substitution at position 915 (C915S) in the ZEB1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.998) (1).

Protein Prediction
Figure 3. Domain structure of Zeb1. The serpens mutation results in the conversion of a cysteine codon to a serine codon at position 915 (C915S) of the encoded protein. Image is interactive; click to view other Zeb1 alleles. The Zeb1 incidental mutation observed in the aoba mice is also shown at position 529 (H529L).  RD, repression domain; p300 P/CAF, p300 P/CAF interaction; ZF, Zinc finger; NZF, N-terminal zinc finger cluster; SID, Smad interaction domain; HBD, homeobox domain; CID, CtBP interaction domain; NC2, NC2 binding; CZF, C-terminal zinc finger cluster; AD, activation domain. This image is interactive; click to show other mutations in Zeb1.

Zeb1 and Zeb2 form the mammalian Zeb family of transcription factors. Zeb1 contains seven C2H2-type zinc finger domains, each approximately 23 amino acids in length (2-5) (Figure 3). Four are clustered near the N-terminus (NZF, spanning aa 150-272) and three near the C-terminus (CZF, spanning aa 882-959). Near the center of the protein is a homeobox domain (aa 559-618). Repressor domains have been identified at the N-terminus (aa 19-127) (6), in a large central region between the two zinc finger clusters (aa 303-902) (7), and in two separate regions within aa 303-902 (aa 302-542 and 760-902) (8).  The region between the CZF domain and the C terminus is highly rich in glutamic acid residues (38%), and has been characterized as an activation domain (aa 1011-1124) (9). Three five-amino acid sequences (PLNLC, PLDLS, PLNLS) between the homeodomain and the CZF domain bind to the co-repressor CtBP, and this region (spanning aa 685-749) is designated the CtBP interaction domain (CID) (10). A region between the NZF and homeobox domains of Zeb1 was identified as a Smad interaction domain (aa 377-456) for Smad1, Smad2, and Smad3 (11). Zeb1 synergizes with TGF-β/BMP in transcriptional activation by aiding in the recruitment of p300 and P/CAF (histone acetylases) through a direct interaction involving the N-terminal region of Zeb1 (12). The negative cofactor NC2 binds to amino acids 726-829 of Zeb1 (9).

 

The serpens mutation results in a cysteine to serine substitution at amino acid 915 within the CZF domain.

 

Please see the record cellophane for more information about Zeb1.

Putative Mechanism

Mice with a truncation of the C terminus of Zeb1 following amino acid 727 (Zeb1ΔC727/ΔC727), and therefore lacking the cluster of C-terminal zinc fingers and the Glu-rich domain, exhibited lethality within two days after birth (13). Like those of Zeb1-/- mice, thymi of surviving Zeb1ΔC727/ΔC727 mice were smaller and contained 0.2% to 1% the number of thymocytes found in wild type mice (13). The medulla and cortex were indistinguishable upon histological analysis of Zeb1ΔC727/ΔC727 thymus sections. Spleen size and cellularity were similar between Zeb1ΔC727/ΔC727 and wild type mice, although there was a trend toward reduced cellularity in Zeb1ΔC727/ΔC727 mice.  Lymph node cellularity was 10% of that in wild type mice. The ENU-induced mutant mice, termed cellophane, exhibited reduced B cell proliferation in response to BCR crosslinking (14). The reduced ability of cellophane B cells to proliferate in response to BCR stimulation is proposed to lead to impaired antibody responses and germinal center formation following immunization. Similar to cellophane mice, the serpens mice also exhibited impaired antibody responses to the T-dependent antigen, indicating reduced function of Zeb1serpens.

Primers PCR Primer
serpens(F):5'- TGGCCTCATCTGCAAAGCAGTG -3'
serpens(R):5'- AACATGCTCAGTCGCCAGGACTTC -3'

Sequencing Primer
serpens_seq(F):5'- CTGCAAAGCAGTGTATAACCTTG -3'
serpens_seq(R):5'- GACTTCCGGCAGGACTTC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler