Phenotypic Mutation 'snowflake' (pdf version)
Allelesnowflake
Mutation Type missense
Chromosome7
Coordinate56,324,680 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) D7H15S12, p, D7H15S12
Chromosomal Location 56,239,760-56,536,518 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM_021879; MGI: 97454
Mapped Yes 
Amino Acid Change Proline changed to Leucine
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: P459L

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000032633)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.235) question?
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI
All alleles(66) : Gene trapped(1) Spontaneous(19) Chemically induced(7) Radiation induced(39
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, gDNA
Repository

none

Last Updated 2018-01-12 4:36 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-04-10
Phenotypic Description
The snowflake mutation was induced by ENU mutagenesis on the C57BL/6J (black) background and was discovered in G3 animals.  Snowflake is a strictly recessive phenotype with very light fur and ocular albinism, similar to the phenotype created by mutations at the Oca2 or p (pink-eyed dilution) locus.  Mutations at Oca2 are known to cause a reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (1;2).
 
Due to a high resemblance in their phenotypes, snowflake and whitemouse mutants were tested for allelism and found to be allelic.  Since snowflake was mapped to Chromosome 7 and is phenotypically similar to classical p locus mutations, sequencing of the p locus was undertaken at the genomic level and the causative mutation was identified for both snowflake and whitemouse mutants.
 
Homozygous snowflake mice exhibit normal resistance to infection with murine cytomegalovirus (MCMV), and similar splenic viral titers to wild type mice after infection.  Susceptibility to L. monocytogenes infection has not been tested in snowflake mice.

 

Nature of Mutation
The snowflake mutation was mapped to Chromosome 7, and corresponds to a C to T transition at position 1506 of the Oca2 transcript, in exon 14 of 24 total exons.
 
1490 GTGCTCAATCTTGATCCGAGACAAGTCCTCATT
454  -V--L--N--L--D--P--R--Q--V--L--I-
 
The mutated nucleotide is indicated in red lettering, and results in a proline to leucine change at amino acid 459 in the OCA2 protein.
Protein Prediction
Figure 1. Domain organization and function of the OCA2 protein. A, Topography. B, Domain structure. The snowflake mutation results in a proline to leucine change at amino acid 459 in the mouse OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.    

The snowflake mutation occurs between the fifth and sixth transmembrane domains of the OCA2 protein and is located on the lumenal side of the vesicular membrane (Figure 1). It is unknown whether normal levels of the altered OCA2 protein exist in snowflake mice or whether this protein is localized appropriately.

 
Please see the record for quicksilver for information about Oca2.
Putative Mechanism
The snowflake mutation results in a P459L change in the lumenal region of the protein located between transmembrane domains 5 and 6.  This region is highly conserved between mouse and human OCA2, but the function is unknown.  Both proline and leucine are nonpolar, neutral amino acids, but proline is often found in turns and is usually solvent-exposed while leucine is hydrophobic.  Amino acid 458 in OCA2 is located in a lumenal loop, more consistent with proline function than with leucine function.  This region of the protein appears to be important for function as the OCA2 mutation occurring in quicksilver and faded mice (E453K), also occurs in the same region.  Human mutations in this region do cause oculocutaneous albinism although none of the mutations lie adjacent to the amino acid affected in snowflake mice.  The lighter coat color of snowflake and whitemouse mutants suggests that the mutations present in these animals more severely impair OCA2 protein function than the mutations present in the darker quicksilver, faded or charbon mice.
 
For a further explanation of the snowflake mutant phenotype, please refer to the record for quicksilver.
Primers Primers cannot be located by automatic search.
Genotyping
Snowflake genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same primers used for quicksilver/faded genotyping are used.
 
Primers for PCR amplification
Quick(F): 5’-GGCTTTCCAAGACATAGACTGTCCC-3’
Quick(R): 5’-GTTCTCAGTGACGAAACCACCTCC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Quick_seq(F): 5’- CACTCTCTGGACTGAAGGAATCTG -3’
Quick_seq(R): 5’- AGCCCCTTAATCTTGAAGACTG -3’
 
The following sequence of 1056 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Oca2) is amplified:
 
84209                               gg ctttccaaga catagactgt cccagggaat
84241 ataggcaaga gatttgtgca gattgctagg taccaagagt ttttgctcat ggtttcccac
84301 attttcatct tccacctatt catagagctt agtcttcaac agatcagggt ataggacttc
84361 caaagatccc aagacaaata tcatgcagcc aacctatagc caagaggaag taaaggtaat
84421 gattcaagta atgagcagag agggtttaaa gtctcttcag aaaagggaga gcacacaagg
84481 gtctaagtca gcaggcttag tgttatttta ttgctggtga tttttgattc cccaccactc
84541 tctggactga aggaatctga tagctgatgt ccattcacct gctccaggcc ctttcctcta
84601 ctgtggccct acacgtggag ctcaacactc ccccagggct gtgggagcag gcagaagcca
84661 taccatcaca cggatagctc agactgtggt gtgtgaactt agaagtatac ttgtaatttg
84721 ttgtatctga ggatgttact gctgatagtc attccctgca ttatgtgtgt tttggggagt
84781 gtgcgtatgt gtgcatgtga atcgatgtgc cttcctgtac aagcaaatac tttaaaaatt
84841 tgggttgtgg acggacctta tcactgtctt ccattcatgg taggttatgt gaagtgctca
84901 atcttgatcc gagacaagtc ctcattgcag aagtgatctt cacaaacatt ggaggagctg
84961 ccactgctat tggggaccca ccaaatgtta tcattgtttc caatcaggag ttgagaaaaa
85021 tggtaggtaa cagcacggta gggttgattt caggaaatgt aaactcaaca gagcactcta
85081 tgcagcttcc tttaataagt actgtgaacc aaggttcttg ctgtcacctg ttcacagcag
85141 gtgctattga tcataagtag tttaggaggg gaaaatcagg agagacagtc ttcaagatta
85201 aggggctgca tttagggcct gtattgacag taacgtgatg ggaggtggtt tcgtcactga
85261 gaac
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsSophie Rutschmann, Karine Crozat, Bruce Beutler
Edit History
2011-01-07 9:35 AM (current)
2010-10-01 10:32 AM
2010-10-01 10:32 AM
2010-02-03 3:13 PM