Screen | TLR9 screen with IFN-gamma priming |
---|---|
Common Name | |
Posted On | 03/17/2017 3:21 PM |
Author | Lei Sun |
Background | |
For more information about the TLR Signaling Screen, please click here. |
|
Reagents and Solutions | |
Brewer’s thioglycolate medium, 4%
4% (w/v) Brewer’s thioglycolate medium powder (BBL Microbiology Systems, Cockeysville, MD) is added to distilled water pre-warmed to 37°C. Solution is autoclaved to sterilize and stored away from light.
PEC medium
Dulbecco’s modified eagle medium (Mediatech Inc., Herndon, VA)
10% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
2mg MTT (Sigma)/mL sterile PBS
IFNγ solution
Stock concentration: 100 μg/mL (R&D systems, 485-MI-100)
CpG solution
Stock concentration: 10 ug/ul (IDT; oligo sequence: TCCATGACGTTCCTGATGCT)
ELISA
TNFα ELISA kit (EBioscience)
|
|
Method | |
Peritoneal exudate cell (PEC) isolation
IFNγ priming
PEC activation with TLR ligands and TNF ELISA
|