Incidental Mutations

88 incidental mutations are currently displayed, and affect 88 genes.
15 are Possibly Damaging.
24 are Probably Damaging.
37 are Probably Benign.
12 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 88 of 88] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 177978 UTSW 9530002B09Rik 0.074 F5770 G1 225 Y 4 122701257 H102L A T missense Het possibly damaging 0.711 0.179 05/07/2014
2 178020 UTSW Abcb5 0.199 F5770 G1 172 Y 12 118886179 M950L T A missense Het probably benign 0.073 0.060 phenotype 05/07/2014
3 177987 UTSW AC139131.1 0.101 F5770 G1 225 Y 7 12481196 T G splice site Het probably benign 05/07/2014
4 177964 UTSW Ahcy 1.000 F5770 G1 225 Y 2 155064921 R151* G A nonsense Het probably null 0.975 ax allele for a deletion that includes the Ahcy gene. [provided by MGI curators] (source: MGI)">phenotype 05/07/2014
5 271553 UTSW Arhgef38 0.000 F5770 G1 23 Y 3 133149540 H262P T G missense Het probably damaging 1.000 0.663 03/23/2015
6 177953 UTSW Atp6v1h 1.000 F5770 G1 225 Y 1 5124443 T282A A G missense Het possibly damaging 0.937 0.346 phenotype 05/07/2014
7 178024 UTSW Camk2g 0.000 F5770 G1 225 Y 14 20739312 T C splice site Het probably benign phenotype 05/07/2014
8 177972 UTSW Casp8ap2 1.000 F5770 G1 160 Y 4 32639944 H333Y C T missense Het probably benign 0.004 0.090 phenotype 05/07/2014
9 177982 UTSW Cd36 0.113 F5770 G1 217 N 5 17820528 ACTGTCTGT ACTGT frame shift Het probably null phenotype 05/07/2014
10 178017 UTSW Cdc42bpb 0.648 F5770 G1 225 Y 12 111296391 G1501S C T missense Het probably benign 0.275 0.087 phenotype 05/07/2014
11 177971 UTSW Cfi 0.000 F5770 G1 225 Y 3 129854992 I175K T A missense Het possibly damaging 0.615 0.179 phenotype 05/07/2014
12 177955 UTSW Clasp1 0.947 F5770 G1 225 Y 1 118581348 R1027Q G A missense Het probably damaging 1.000 0.144 phenotype 05/07/2014
13 177965 UTSW D630003M21Rik 0.072 F5770 G1 225 Y 2 158201011 T870A T C missense Het probably benign 0.377 0.069 05/07/2014
14 178015 UTSW Dcaf4 0.070 F5770 G1 225 Y 12 83537701 C A splice site Het probably null 0.976 phenotype 05/07/2014
15 178025 UTSW Dnah12 0.268 F5770 G1 225 Y 14 26773093 N1369K T A missense Het possibly damaging 0.955 0.097 05/07/2014
16 178028 UTSW Dnajc22 0.085 F5770 G1 184 Y 15 99101482 Y183N T A missense Het probably damaging 0.993 0.393 05/07/2014
17 177970 UTSW Dpyd 0.000 F5770 G1 225 Y 3 118897126 Q295* C T nonsense Het probably null 0.971 phenotype 05/07/2014
18 177960 UTSW Erv3 0.075 F5770 G1 225 Y 2 131855926 H171R T C missense Het possibly damaging 0.663 0.179 05/07/2014
19 177975 UTSW Fam221b 0.072 F5770 G1 225 Y 4 43665865 T249A T C missense Het probably benign 0.000 0.090 05/07/2014
20 177984 UTSW Fbrsl1 0.092 F5770 G1 225 Y 5 110379426 A129T C T missense Het possibly damaging 0.904 0.179 05/07/2014
21 177969 UTSW Fcgr1 0.497 F5770 G1 225 Y 3 96284276 *405W T C makesense Het probably null 0.976 phenotype 05/07/2014
22 271552 UTSW Gdap1l1 0.195 F5770 G1 97 Y 2 163447486 C T intron Het probably benign phenotype 03/23/2015
23 177996 UTSW Glrx3 1.000 F5770 G1 225 Y 7 137459153 H172R A G missense Het probably benign 0.000 0.061 phenotype 05/07/2014
24 177962 UTSW Gm10770 0.141 F5770 G1 225 Y 2 150179484 K38* T A nonsense Het probably null 0.972 05/07/2014
25 178033 UTSW Gm20517 F5770 G1 225 Y 17 47618832 V65M G A missense Het probably damaging 0.997 0.462 05/07/2014
26 178014 UTSW Gm4787 0.061 F5770 G1 225 Y 12 81377567 Q606* G A nonsense Het probably null 0.976 05/07/2014
27 178003 UTSW Golga4 0.000 F5770 G1 225 Y 9 118556075 E727G A G missense Het possibly damaging 0.619 0.179 phenotype 05/07/2014
28 178036 UTSW Got1 1.000 F5770 G1 225 Y 19 43500561 T A unclassified Het probably benign phenotype 05/07/2014
29 178012 UTSW Heatr5a 0.293 F5770 G1 186 Y 12 51881278 A G splice site Het probably benign 0.090 05/07/2014
30 178029 UTSW Hira 1.000 F5770 G1 225 Y 16 18894821 A29T G A missense Het probably damaging 1.000 0.787 phenotype 05/07/2014
31 178006 UTSW Hnrnpab 0.738 F5770 G1 225 Y 11 51602624 N252K A T missense Het probably benign 0.394 0.090 phenotype 05/07/2014
32 177998 UTSW Ing1 0.959 F5770 G1 225 Y 8 11561934 V124A T C missense Het probably damaging 0.999 0.616 phenotype 05/07/2014
33 178004 UTSW Izumo4 0.000 F5770 G1 225 Y 10 80703891 T155S A T missense Het probably benign 0.024 0.076 05/07/2014
34 177954 UTSW Kcnb2 0.000 F5770 G1 225 Y 1 15710091 I396V A G missense Het probably benign 0.070 0.187 phenotype 05/07/2014
35 178018 UTSW Klc1 0.414 F5770 G1 223 Y 12 111774572 I161F A T missense Het probably benign 0.089 0.096 phenotype 05/07/2014
36 177986 UTSW Lpar5 0.075 F5770 G1 128 Y 6 125081727 A137E C A missense Het possibly damaging 0.883 0.179 phenotype 05/07/2014
37 177957 UTSW Lrp4 0.612 F5770 G1 225 Y 2 91488518 S900L C T missense Het possibly damaging 0.956 0.179 phenotype 05/07/2014
38 178009 UTSW Lrrc37a 0.135 F5770 G1 225 Y 11 103455512 N3176T T G missense Het possibly damaging 0.948 0.179 05/07/2014
39 271551 UTSW Mbd5 1.000 F5770 G1 225 Y 2 49316410 D1713G A G missense Het probably damaging 0.991 0.140 phenotype 03/23/2015
40 177990 UTSW Mctp2 0.182 F5770 G1 185 Y 7 72121751 T A splice site Het probably benign 05/07/2014
41 177997 UTSW Muc6 0.125 F5770 G1 225 Y 7 141647613 E808A T G missense Het probably benign 0.109 0.090 phenotype 05/07/2014
42 178031 UTSW Mylk 0.000 F5770 G1 225 Y 16 34995204 G T critical splice donor site 1 bp Het probably null 0.949 phenotype 05/07/2014
43 178005 UTSW Myrfl 0.000 F5770 G1 211 Y 10 116861530 T30A T C missense Het probably damaging 0.997 0.123 05/07/2014
44 178002 UTSW Nbeal2 0.339 F5770 G1 225 Y 9 110637937 V670A A G missense Het possibly damaging 0.647 0.159 phenotype 05/07/2014
45 178001 UTSW Nphp3 1.000 F5770 G1 225 Y 9 104035894 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 05/07/2014
46 177988 UTSW Numbl 0.000 F5770 G1 193 Y 7 27279602 S379P T C missense Het probably benign 0.000 0.090 phenotype 05/07/2014
47 177956 UTSW Olfr1406 0.113 F5770 G1 225 Y 1 173183964 L157I G T missense Het probably benign 0.045 0.090 phenotype 05/07/2014
48 178035 UTSW Olfr1440 0.088 F5770 G1 225 Y 19 12394550 V96I G A missense Het probably benign 0.188 0.090 phenotype 05/07/2014
49 177994 UTSW Olfr480 0.144 F5770 G1 225 Y 7 108066678 T40K G T missense Het probably benign 0.109 0.090 phenotype 05/07/2014
50 178010 UTSW Otop3 0.076 F5770 G1 183 Y 11 115344838 L432Q T A missense Het probably damaging 1.000 0.609 05/07/2014
51 178016 UTSW Papln 0.000 F5770 G1 225 Y 12 83778834 R608C C T missense Het possibly damaging 0.722 0.179 05/07/2014
52 178007 UTSW Pelp1 0.952 F5770 G1 225 Y 11 70398150 T257S T A missense Het probably damaging 0.986 0.063 phenotype 05/07/2014
53 178030 UTSW Pigx 0.150 F5770 G1 160 Y 16 32087422 D129G T C missense Het probably damaging 1.000 0.682 phenotype 05/07/2014
54 177980 UTSW Pik3cd 0.952 F5770 G1 225 Y 4 149657319 L390R A C missense Het probably damaging 1.000 0.943 phenotype 05/07/2014
55 177993 UTSW Plekhb1 0.000 F5770 G1 170 Y 7 100654618 T112A T C missense Het probably benign 0.355 0.145 phenotype 05/07/2014
56 178023 UTSW Ppwd1 0.951 F5770 G1 225 Y 13 104220237 Y257H A G missense Het probably damaging 0.979 0.220 05/07/2014
57 177995 UTSW Prkcb 0.000 F5770 G1 225 Y 7 122528476 W274C G T missense Het probably damaging 0.993 0.925 phenotype 05/07/2014
58 178008 UTSW Rabep1 0.510 F5770 G1 225 Y 11 70937516 T C splice site Het probably benign 0.090 05/07/2014
59 178013 UTSW Ralgapa1 0.829 F5770 G1 225 Y 12 55795653 G A splice site Het probably benign 0.090 phenotype 05/07/2014
60 178022 UTSW Rasa1 1.000 F5770 G1 166 Y 13 85226945 A G unclassified 3476 bp Het probably null phenotype 05/07/2014
61 177967 UTSW Rbbp8nl 0.055 F5770 G1 220 Y 2 180278208 T558S T A missense Het probably benign 0.028 0.123 05/07/2014
62 178027 UTSW Recql4 1.000 F5770 G1 225 Y 15 76706169 D705G T C missense Het possibly damaging 0.790 0.063 phenotype 05/07/2014
63 177976 UTSW Ror1 1.000 F5770 G1 194 Y 4 100440933 Q501R A G missense Het probably damaging 0.989 0.160 phenotype 05/07/2014
64 177981 UTSW Rundc3b 0.494 F5770 G1 117 N 5 8622549 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC small deletion Het probably benign 05/07/2014
65 177968 UTSW Sirpb1b 0.077 F5770 G1 59 Y 3 15503183 V366A A G missense Het probably benign 0.254 0.152 05/07/2014
66 177959 UTSW Slc30a4 0.000 F5770 G1 225 Y 2 122689538 M136L T A missense Het probably benign 0.001 0.077 phenotype 05/07/2014
67 177983 UTSW Slc5a6 1.000 F5770 G1 142 Y 5 31042613 C T unclassified Het probably null 0.898 05/07/2014
68 177973 UTSW Spaca1 0.000 F5770 G1 225 Y 4 34039311 E192G T C missense Het probably damaging 0.989 0.165 phenotype 05/07/2014
69 178021 UTSW Spata31 0.346 F5770 G1 225 Y 13 64921648 P537T C A missense Het probably benign 0.178 0.090 05/07/2014
70 178034 UTSW Sptbn2 0.000 F5770 G1 225 Y 19 4750632 R2292C C T missense Het probably damaging 1.000 0.737 phenotype 05/07/2014
71 177961 UTSW Thbd 1.000 F5770 G1 179 Y 2 148407190 Y253N A T missense Het probably benign 0.051 0.090 phenotype 05/07/2014
72 178032 UTSW Tiam1 0.000 F5770 G1 139 Y 16 89865271 R653H C T missense Het probably damaging 1.000 0.327 phenotype 05/07/2014
73 177991 UTSW Tmc3 0.000 F5770 G1 225 Y 7 83622505 V955A T C missense Het probably benign 0.009 0.090 05/07/2014
74 178011 UTSW Tnrc6c 0.000 F5770 G1 225 Y 11 117723326 R770H G A missense Het probably damaging 1.000 0.374 phenotype 05/07/2014
75 177977 UTSW Toe1 1.000 F5770 G1 225 Y 4 116806111 N56K A T missense Het probably damaging 1.000 0.907 05/07/2014
76 177985 UTSW Tprkb 0.197 F5770 G1 225 Y 6 85928782 K150E A G missense Het probably damaging 0.957 0.527 05/07/2014
77 178026 UTSW Trps1 1.000 F5770 G1 225 Y 15 50831577 K150E T C missense Het probably damaging 0.999 0.429 phenotype 05/07/2014
78 177963 UTSW Tspyl3 0.087 F5770 G1 225 N 2 153225060 V86A A G missense Het probably benign 0.070 05/07/2014
79 177989 UTSW Ttc23 0.062 F5770 G1 225 Y 7 67709315 T C splice site Het probably benign 05/07/2014
80 271554 UTSW Ttc36 0.000 F5770 G1 225 Y 9 44801797 A T unclassified Het probably benign phenotype 03/23/2015
81 177999 UTSW Tubb3 1.000 F5770 G1 225 Y 8 123411675 C T splice site Het probably benign phenotype 05/07/2014
82 177992 UTSW Vmn2r68 0.122 F5770 G1 225 Y 7 85221880 V732I C T missense Het probably benign 0.007 0.090 05/07/2014
83 177958 UTSW Vps18 1.000 F5770 G1 225 Y 2 119297228 Y844C A G missense Het probably benign 0.220 0.125 phenotype 05/07/2014
84 178019 UTSW Wdr60 1.000 F5770 G1 225 Y 12 116211840 S906A A C missense Het possibly damaging 0.730 0.136 phenotype 05/07/2014
85 178000 UTSW Wdr72 0.138 F5770 G1 225 Y 9 74157270 I528N T A missense Het probably damaging 0.959 0.647 phenotype 05/07/2014
86 177974 UTSW Zfp292 0.716 F5770 G1 225 Y 4 34806783 C2087Y C T missense Het possibly damaging 0.853 0.179 05/07/2014
87 177979 UTSW Zfp933 0.080 F5770 G1 225 Y 4 147826470 A223V G A missense Het probably damaging 0.980 0.217 05/07/2014
88 177966 UTSW Zmynd8 1.000 F5770 G1 225 Y 2 165812394 R724* G A nonsense Het probably null 0.976 phenotype 05/07/2014
[records 1 to 88 of 88]