Incidental Mutations

148 incidental mutations are currently displayed, and affect 120 genes.
4 are Possibly Damaging.
11 are Probably Damaging.
115 are Probably Benign.
16 are Probably Null.
4 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 148] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 512099 UTSW 1700001K19Rik 0.067 FR4548 214.47 N 12 110668449 CTT CTTTTT unclassified Het probably benign 04/05/2018
2 512100 UTSW 1700001K19Rik 0.067 FR4548 217.47 N 12 110668452 CTT CTTTTT unclassified Het probably benign 04/05/2018
3 512002 UTSW 2010300C02Rik 0.000 FR4548 222 N 1 37625035 E594V T A missense Homo probably benign 0.399 04/05/2018
4 512003 UTSW 2010300C02Rik 0.000 FR4548 222 N 1 37625036 E594* C A nonsense Homo probably null 04/05/2018
5 512004 UTSW 2010300C02Rik 0.000 FR4548 88 N 1 37625102 S47P A G missense Homo probably damaging 0.958 04/05/2018
6 512052 UTSW 4930433I11Rik 0.068 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
7 512078 UTSW 4932415D10Rik 0.070 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
8 512101 UTSW Abt1 0.961 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
9 512028 UTSW Ahdc1 0.267 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
10 512029 UTSW Ahdc1 0.267 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
11 512139 UTSW AI837181 0.000 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
12 512140 UTSW AI837181 0.000 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
13 512069 UTSW Anxa2 0.000 FR4548 104.47 N 9 69480203 CCC CCCTCC small insertion Het probably benign phenotype 04/05/2018
14 512105 UTSW Anxa7 0.194 FR4548 222 N 14 20469411 G113E C T missense Homo probably damaging 0.967 0.647 phenotype 04/05/2018
15 512138 UTSW Apc 0.970 FR4548 217.47 N 18 34281998 CCAATAAAG CCAATAAAGACAATAAAG intron Het probably benign phenotype 04/05/2018
16 512117 UTSW Apol6 0.057 FR4548 214.46 N 15 77051445 T TGTTA frame shift Homo probably null phenotype 04/05/2018
17 512130 UTSW BC051142 0.491 FR4548 157.47 N 17 34460065 GCA GCATCA unclassified Het probably benign 04/05/2018
18 512054 UTSW Blm 1.000 FR4548 214.46 N 7 80463769 CTAC CTACTTAC frame shift Homo probably null phenotype 04/05/2018
19 512129 UTSW Brd2 1.000 FR4548 217.47 N 17 34116336 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA unclassified Het probably benign phenotype 04/05/2018
20 512042 UTSW Bud31 0.960 FR4548 82.01 N 5 145146535 R63C C T missense Het probably benign 0.022 04/05/2018
21 512131 UTSW C4b 0.000 FR4548 119.01 N 17 34740997 R335H C T missense Het probably benign 0.002 phenotype 04/05/2018
22 512062 UTSW Cacna1a 0.931 FR4548 217.47 N 8 84638717 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
23 512147 UTSW Cacna1f 0.000 FR4548 137.47 N X 7620058 AGG AGGGGG utr 3 prime Het probably benign phenotype 04/05/2018
24 512075 UTSW Ccdc170 0.378 FR4548 118.47 N 10 4561026 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
25 512058 UTSW Cckbr 0.065 FR4548 146.51 N 7 105434681 GGGC G small deletion Homo probably benign phenotype 04/05/2018
26 512049 UTSW Cd3eap 1.000 FR4548 130.46 N 7 19357244 GGATG GG unclassified Homo probably benign 04/05/2018
27 512124 UTSW Cd80 0.168 FR4548 207.54 N 16 38486319 GAAA GAAAAAA small insertion Homo probably benign phenotype 04/05/2018
28 512063 UTSW Ces1b 0.057 FR4548 89.01 N 8 93068092 N293S T C missense Homo probably null 0.000 04/05/2018
29 512070 UTSW Cgnl1 0.000 FR4548 212.47 N 9 71724717 CGC CGCGGC small insertion Het probably benign phenotype 04/05/2018
30 512092 UTSW Cntnap1 0.452 FR4548 217.47 N 11 101189572 CCCAGC CCCAGCGCCAGC unclassified Het probably benign phenotype 04/05/2018
31 512093 UTSW Cntnap1 0.452 FR4548 217.47 N 11 101189579 CCAGCC CCAGCCTCAGCC unclassified Het probably benign phenotype 04/05/2018
32 512094 UTSW Cntnap1 0.452 FR4548 217.47 N 11 101189593 AGCC AGCCCCCGCC unclassified Het probably benign phenotype 04/05/2018
33 512095 UTSW Cntnap1 0.452 FR4548 217.47 N 11 101189594 GCC GCCCCAACC unclassified Het probably benign phenotype 04/05/2018
34 512103 UTSW Ctsm 0.000 FR4548 214.46 N 13 61537837 GTGA GTGAATGA frame shift Homo probably null 04/05/2018
35 512043 UTSW Cttnbp2 0.000 FR4548 217.47 N 6 18367463 TGCTGC TGCTGCCGCTGC utr 3 prime Het probably benign phenotype 04/05/2018
36 512072 UTSW Dbr1 1.000 FR4548 217.47 N 9 99583673 GAGGAG GAGGAGTAGGAG nonsense Het probably null phenotype 04/05/2018
37 512007 UTSW Dusp10 0.742 FR4548 222 N 1 184037056 C73F G T missense Homo probably damaging 0.996 0.550 phenotype 04/05/2018
38 512018 UTSW Efna4 FR4548 214.46 N 3 89334422 ATGTGAT A unclassified Homo probably benign phenotype 04/05/2018
39 512144 UTSW Eif3a 0.970 FR4548 214.46 N 19 60775291 A ATTTTT critical splice donor site Homo probably benign 04/05/2018
40 512008 UTSW Ermn 0.000 FR4548 205.47 N 2 58048075 TTC TTCATC unclassified Het probably benign 04/05/2018
41 512009 UTSW Ermn 0.000 FR4548 217.47 N 2 58048088 TC TCTCC unclassified Het probably benign 04/05/2018
42 512116 UTSW Fbxo43 0.184 FR4548 217.47 N 15 36152098 GTGCCT GTGCCTATGCCT nonsense Het probably null phenotype 04/05/2018
43 512097 UTSW Fscb 0.095 FR4548 107.01 N 12 64472563 S710P A G missense Het unknown 04/05/2018
44 512098 UTSW Fscb 0.095 FR4548 113.01 N 12 64472565 Q709L T A missense Het unknown 04/05/2018
45 512087 UTSW Glod4 0.155 FR4548 104.51 N 11 76243310 A C start gained Homo probably benign 04/05/2018
46 512013 UTSW Gm14401 0.157 FR4548 87.01 N 2 177086868 D249G A G missense Het probably benign 0.000 04/05/2018
47 512079 UTSW Gm4340 FR4548 164.47 N 10 104196070 AGC AGCCGC small insertion Het probably benign 04/05/2018
48 512080 UTSW Gm4340 FR4548 193.47 N 10 104196073 AGC AGCGGC small insertion Het probably benign 04/05/2018
49 512107 UTSW Gm8104 0.133 FR4548 93.01 N 14 43110009 T178I C T missense Het probably benign 0.048 04/05/2018
50 512108 UTSW Gm8104 0.133 FR4548 95.01 N 14 43110011 S179P T C missense Het probably damaging 0.984 04/05/2018
51 512136 UTSW Gpatch11 0.131 FR4548 217.47 N 17 78842175 GGAAGA GGAAGACGAAGA small insertion Het probably benign 04/05/2018
52 512128 UTSW H2-K1 0.118 FR4548 202.46 N 17 33997042 GTTT G unclassified Homo probably benign phenotype 04/05/2018
53 512102 UTSW Hist1h1t 0.000 FR4548 133.46 N 13 23695920 GAGAA GA unclassified Homo probably benign phenotype 04/05/2018
54 512133 UTSW Hspa1b 0.323 FR4548 122.46 N 17 34957129 GCGCC GC small deletion Homo probably benign phenotype 04/05/2018
55 512006 UTSW Ifi211 0.069 FR4548 87.01 N 1 173906193 A134V G A missense Het possibly damaging 0.852 phenotype 04/05/2018
56 512053 UTSW Igf1r 1.000 FR4548 217.51 N 7 68226186 C CTGGAGATGGAGG small insertion Het probably benign phenotype 04/05/2018
57 512044 UTSW Igkv9-129 FR4548 85.01 N 6 67840034 V41I G A missense Het probably damaging 1.000 04/05/2018
58 512005 UTSW Ipo9 1.000 FR4548 217.47 N 1 135386275 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
59 512064 UTSW Kcng4 0.000 FR4548 222 N 8 119633519 Y39* G T nonsense Homo probably null 0.975 phenotype 04/05/2018
60 512048 UTSW Klra2 0.058 FR4548 217.47 N 6 131221851 AG AGAAATCCACGG frame shift Het probably null phenotype 04/05/2018
61 512051 UTSW Kmt2b 1.000 FR4548 217.47 N 7 30586380 CTCC CTCCTCGTCC unclassified Het probably benign phenotype 04/05/2018
62 512123 UTSW Kng2 0.000 FR4548 225.01 N 16 23000552 Q245* G A nonsense Het probably null 04/05/2018
63 512068 UTSW Kri1 1.000 FR4548 217.47 N 9 21281050 CTCCTCTTCCTC CTCCTC small deletion Het probably benign phenotype 04/05/2018
64 512090 UTSW Krt10 0.319 FR4548 217.47 N 11 99389273 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
65 512091 UTSW Krt10 0.319 FR4548 214.46 N 11 99389276 TCCTCCAC TCCTCCACCTCCAC unclassified Homo probably benign phenotype 04/05/2018
66 512148 UTSW Las1l FR4548 217.47 N X 95940625 TC TCTTCCGC small insertion Het probably benign 04/05/2018
67 512149 UTSW Las1l FR4548 204.47 N X 95940823 GAG GAGAAG small insertion Het probably benign 04/05/2018
68 512021 UTSW Lrit3 0.000 FR4548 217.47 N 3 129788813 GCT GCTACT small insertion Het probably benign phenotype 04/05/2018
69 512022 UTSW Lrit3 0.000 FR4548 217.47 N 3 129788816 GCT GCTACT small insertion Het probably benign phenotype 04/05/2018
70 512112 UTSW Lrrc63 0.091 FR4548 214.46 N 14 75125182 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG small deletion Homo probably benign 04/05/2018
71 512031 UTSW Luzp1 0.879 FR4548 214.46 N 4 136543188 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA small insertion Homo probably benign phenotype 04/05/2018
72 512104 UTSW Mast4 0.302 FR4548 214.54 N 13 102736318 CA CAGTGGGA small insertion Homo probably benign phenotype 04/05/2018
73 512017 UTSW Med12l 0.207 FR4548 186.47 N 3 59275982 AGC AGCGGC small insertion Het probably benign phenotype 04/05/2018
74 512039 UTSW Mn1 1.000 FR4548 165.47 N 5 111419698 GCA GCACCA small insertion Het probably benign phenotype 04/05/2018
75 512143 UTSW Morn4 0.180 FR4548 217.47 N 19 42076109 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG small insertion Het probably benign 04/05/2018
76 512066 UTSW Msantd4 0.225 FR4548 222 N 9 4384937 I221F A T missense Homo possibly damaging 0.505 04/05/2018
77 512025 UTSW Mup21 0.067 FR4548 217.47 N 4 62149345 TATACTT TATACTTTTTAAATACTT critical splice donor site Het probably benign 04/05/2018
78 512026 UTSW Mup21 0.067 FR4548 217.47 N 4 62149346 ATACTT ATACTTTTTATCTACTT critical splice donor site Het probably benign 04/05/2018
79 512081 UTSW Nacad 0.000 FR4548 217.47 N 11 6599752 AGGGTC AGGGTCGGGGTC small insertion Het probably benign 04/05/2018
80 512082 UTSW Nacad 0.000 FR4548 207.47 N 11 6599760 GG GGCCAGTG small insertion Het probably benign 04/05/2018
81 512047 UTSW Ncapd2 0.969 FR4548 214.46 N 6 125173596 CTT CTTGGTT critical splice donor site Homo probably benign 04/05/2018
82 512132 UTSW Nelfe 1.000 FR4548 214.46 N 17 34854070 GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC unclassified Homo probably benign phenotype 04/05/2018
83 512038 UTSW Nfxl1 0.203 FR4548 217.55 N 5 72559115 CCGGGG CCGGGGTCGGGG small insertion Het probably benign 04/05/2018
84 512111 UTSW Nkx2-6 0.000 FR4548 205.07 N 14 69175229 T282M C T missense Homo probably damaging 0.996 phenotype 04/05/2018
85 512035 UTSW Noc2l 1.000 FR4548 106.46 N 4 156240092 AGGC AGGCGGC small insertion Homo probably benign phenotype 04/05/2018
86 512036 UTSW Noc2l 1.000 FR4548 123.47 N 4 156240100 GC GCTTC small insertion Het probably benign phenotype 04/05/2018
87 512073 UTSW Nphp3 1.000 FR4548 180.47 N 9 104025939 CACG C small deletion Het probably benign phenotype 04/05/2018
88 512106 UTSW Nrg3 0.127 FR4548 214.46 N 14 38397271 TTG TTGACACTG small insertion Homo probably benign phenotype 04/05/2018
89 512086 UTSW Olfr313 0.069 FR4548 151 N 11 58817440 V144D T A missense Homo possibly damaging 0.797 0.177 phenotype 04/05/2018
90 512085 UTSW Olfr318 0.137 FR4548 93.01 N 11 58720371 I226L T G missense Het probably benign 0.000 phenotype 04/05/2018
91 512055 UTSW Olfr585 0.070 FR4548 214.46 N 7 103098309 T TTAG nonsense Homo probably null phenotype 04/05/2018
92 512056 UTSW Olfr624 0.157 FR4548 214.46 N 7 103670960 CAAA CAAAAAA small insertion Homo probably benign phenotype 04/05/2018
93 512057 UTSW Olfr624 0.157 FR4548 214.46 N 7 103670967 G GAAC nonsense Homo probably null phenotype 04/05/2018
94 512114 UTSW Osmr 0.064 FR4548 214.97 N 15 6837703 CTC CTCTTC small insertion Homo probably benign phenotype 04/05/2018
95 512010 UTSW Patl2 0.092 FR4548 217.47 N 2 122126135 GCT GCTCCT small insertion Het probably benign 04/05/2018
96 512030 UTSW Pdik1l 0.000 FR4548 214.46 N 4 134279512 ACCAC ACCACCGCCAC intron Homo probably benign 04/05/2018
97 512050 UTSW Phldb3 0.102 FR4548 217.47 N 7 24628978 GACCC G makesense Het probably null 04/05/2018
98 512065 UTSW Piezo1 1.000 FR4548 222 N 8 122495569 R503W G A missense Homo probably damaging 1.000 0.265 phenotype 04/05/2018
99 512141 UTSW Pik3ap1 0.000 FR4548 214.46 N 19 41281945 AG AGGGG small insertion Homo probably benign phenotype 04/05/2018
100 512121 UTSW Pkdrej 0.099 FR4548 214.46 N 15 85819680 TG TGGGAGCG small insertion Homo probably benign phenotype 04/05/2018
[records 1 to 100 of 148] next >> last >|