Incidental Mutations

114 incidental mutations are currently displayed, and affect 112 genes.
2 are Possibly Damaging.
7 are Probably Damaging.
90 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 114] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 478174 UTSW 1700007G11Rik 0.115 LCD18 G1 999 Y 5 98707508 G A intron Het probably benign 05/26/2017
2 478031 UTSW 4930548H24Rik 0.067 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
3 484581 UTSW 9530077C05Rik 0.000 LCD18 G1 2735.94 Y 9 22442083 N intron Het probably benign 0.090 08/15/2017
4 478194 UTSW A330008L17Rik 0.245 LCD18 G1 999 Y 8 99723425 A G intron Het noncoding transcript 05/26/2017
5 478219 UTSW Aaed1 0.100 LCD18 G1 119 Y 13 64287285 G A unclassified Het probably benign 05/26/2017
6 478243 UTSW Aff2 0.307 LCD18 G1 999 Y X 69747535 C A intron Het probably benign phenotype 05/26/2017
7 478240 UTSW Aldh1a1 0.824 LCD18 G1 999 Y 19 20626646 C A intron Het probably benign phenotype 05/26/2017
8 478060 UTSW Anxa7 0.140 LCD18 G1 999 Y 14 20469411 G113E C T missense Het probably damaging 0.967 0.647 phenotype 05/17/2017
9 478187 UTSW Apba2 0.173 LCD18 G1 999 Y 7 64622160 A T intron Het probably benign 0.090 phenotype 05/26/2017
10 478203 UTSW Apc2 0.231 LCD18 G1 999 Y 10 80299974 G C intron Het probably benign 0.090 phenotype 05/26/2017
11 478231 UTSW App 0.623 LCD18 G1 999 Y 16 85025412 C G splice site Het probably benign phenotype 05/26/2017
12 478206 UTSW Asic2 0.000 LCD18 G1 999 Y 11 80985744 C A intron Het probably benign phenotype 05/26/2017
13 478246 UTSW Btk 0.367 LCD18 G1 999 Y X 134578825 T C intron Het probably benign phenotype 05/26/2017
15 478199 UTSW Car12 0.000 LCD18 G1 999 Y 9 66761676 C A intron Het probably benign phenotype 05/26/2017
16 478228 UTSW Ccdc191 0.414 LCD18 G1 999 Y 16 43921801 G A intron Het probably benign 05/26/2017
17 478287 UTSW Ccdc34 0.071 LCD18 G1 1485.22 Y 2 110016318 N unclassified Het probably benign 06/09/2017
18 478053 UTSW Cd164 0.179 LCD18 G1 999 Y 10 41521926 A59S G T missense Het probably benign 0.003 0.090 phenotype 05/17/2017
19 478038 UTSW Cd22 0.000 LCD18 G1 999 Y 7 30878082 R2H C T missense Het possibly damaging 0.948 0.179 phenotype 05/17/2017
20 478049 UTSW Cdv3 0.102 LCD18 G1 121 N 9 103365343 A T unclassified Het probably benign 05/17/2017
21 478050 UTSW Cdv3 0.102 LCD18 G1 124 N 9 103365354 C A unclassified Het probably benign 05/17/2017
22 478285 UTSW Celf2 0.635 LCD18 G1 3478.55 Y 2 6779076 N intron Het probably benign phenotype 06/09/2017
23 478195 UTSW Clec18a 0.075 LCD18 G1 999 Y 8 111076136 C A splice site Het probably benign 05/26/2017
24 523297 UTSW Cnpy3 1.000 LCD18 G1 46.7 Y 17 46737536 GGATGGAT GGATAGATAGATAGATAGATGGAT intron Het probably benign phenotype 06/21/2018
25 478183 UTSW Cntn4 0.379 LCD18 G1 999 Y 6 106553940 A G intron Het probably benign phenotype 05/26/2017
26 478235 UTSW Cntnap5c 0.079 LCD18 G1 999 Y 17 58162160 G C intron Het probably benign 05/26/2017
27 478065 UTSW Col2a1 1.000 LCD18 G1 999 N 15 97988981 C A synonymous Het probably null 0.976 phenotype 05/17/2017
28 478163 UTSW Cpne3 0.152 LCD18 G1 999 Y 4 19563382 G T intron Het probably benign phenotype 05/26/2017
29 478164 UTSW Dab1 0.889 LCD18 G1 999 Y 4 104046572 T G intron Het probably benign phenotype 05/26/2017
30 478161 UTSW Dapp1 0.110 LCD18 G1 999 Y 3 137939400 G A intron Het probably benign phenotype 05/26/2017
31 478239 UTSW Dcc 1.000 LCD18 G1 999 Y 18 72297447 G A intron Het probably benign phenotype 05/26/2017
32 478025 UTSW Dcun1d1 0.725 LCD18 G1 999 Y 3 35938005 GAAAAAAAAA GAAAAAAAAAA unclassified Het probably benign 05/17/2017
33 478150 UTSW Dennd1b 0.000 LCD18 G1 999 Y 1 139114764 G A intron Het probably benign 0.090 phenotype 05/26/2017
34 478029 UTSW Dhdds 1.000 LCD18 G1 999 Y 4 133970363 TAA TA utr 3 prime Het probably benign phenotype 05/17/2017
35 478061 UTSW Dnah12 0.159 LCD18 G1 999 Y 14 26849385 G2817V G T missense Het probably damaging 1.000 0.299 05/17/2017
36 478021 UTSW Dnm3 0.000 LCD18 G1 104 Y 1 162406561 CATATATATATATATATATATATA CATATATATATATATATATATA intron Het probably benign phenotype 05/17/2017
37 478283 UTSW Dock10 0.344 LCD18 G1 779.4 Y 1 80716623 N intron Het probably benign phenotype 06/09/2017
38 478023 UTSW Dusp10 0.682 LCD18 G1 999 Y 1 184037056 C73F G T missense Het probably damaging 0.996 0.550 phenotype 05/17/2017
39 478191 UTSW Fgf20 0.000 LCD18 G1 999 Y 8 40292318 A C intron Het probably benign phenotype 05/26/2017
40 478208 UTSW Ftsj3 0.962 LCD18 G1 999 Y 11 106250059 G T splice site Het probably benign phenotype 05/26/2017
41 478146 UTSW Gls 1.000 LCD18 G1 999 Y 1 52183367 T G intron Het probably benign phenotype 05/26/2017
42 478205 UTSW Gm12130 0.410 LCD18 G1 999 Y 11 38506923 T C intron Het noncoding transcript 05/26/2017
43 478028 UTSW Gm12394 LCD18 G1 80.7 N 4 42792885 T416A T C missense Het probably benign 0.065 05/17/2017
44 478245 UTSW Gm14936 0.163 LCD18 G1 999 Y X 112998750 G A intron Het noncoding transcript 05/26/2017
45 478180 UTSW Gm16630 0.180 LCD18 G1 999 Y 6 48141269 C T intron Het noncoding transcript 05/26/2017
46 478052 UTSW Gm22194 0.145 LCD18 G1 999 Y 10 11940963 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG exon Het noncoding transcript 05/17/2017
47 478067 UTSW Gm26917 0.162 LCD18 G1 999 Y 17 39843971 C G unclassified Het noncoding transcript 05/17/2017
48 478148 UTSW Gm35048 0.117 LCD18 G1 77.1 Y 1 90521526 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC exon Het noncoding transcript 05/26/2017
49 478230 UTSW Gm37311 0.107 LCD18 G1 999 Y 16 77618281 G A intron Het noncoding transcript 0.087 05/26/2017
50 478027 UTSW Gm37928 0.048 LCD18 G1 999 Y 3 118534557 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA unclassified Het noncoding transcript 05/17/2017
51 478068 UTSW Gm42418 0.147 LCD18 G1 999 Y 17 39848555 T C exon Het noncoding transcript 05/17/2017
52 478204 UTSW Gm4302 0.504 LCD18 G1 57.7 Y 10 100341444 W197R T C missense Het probably benign 0.196 0.090 05/26/2017
53 478197 UTSW Gm5615 0.129 LCD18 G1 999 Y 9 36533553 T C utr 3 prime Het probably benign 0.090 05/26/2017
54 478066 UTSW H2-Q4 0.060 LCD18 G1 999 Y 17 35380405 D155N G A missense Het probably damaging 1.000 0.647 phenotype 05/17/2017
55 478234 UTSW H2-T23 0.055 LCD18 G1 78.4 Y 17 36031216 T C intron Het probably benign phenotype 05/26/2017
56 478209 UTSW Hgs 0.163 LCD18 G1 999 Y 11 120469578 CTTTTTTT CTTTTTT splice site Het probably benign phenotype 05/26/2017
57 478059 UTSW Ighv5-9 0.109 LCD18 G1 999 Y 12 113661877 S82N C T missense Het probably benign 0.017 0.090 05/17/2017
58 478227 UTSW Il1rap 0.000 LCD18 G1 999 Y 16 26631593 C A intron Het probably benign phenotype 05/26/2017
59 499809 UTSW Inhbc 0.000 LCD18 G1 606.46 Y 10 127367140 N intron Het probably benign phenotype 11/21/2017
60 478193 UTSW Inpp4b 0.293 LCD18 G1 999 Y 8 81693010 C T intron Het probably benign phenotype 05/26/2017
61 484580 UTSW Kars 1.000 LCD18 G1 549.59 Y 8 111993708 N critical splice acceptor site Het probably benign phenotype 08/15/2017
62 478044 UTSW Kcng4 0.000 LCD18 G1 999 Y 8 119633519 Y39* G T nonsense Het probably null 0.975 phenotype 05/17/2017
63 478155 UTSW Kcnh7 0.119 LCD18 G1 999 Y 2 63049799 A G intron Het probably benign phenotype 05/26/2017
64 478224 UTSW Klhl1 0.159 LCD18 G1 999 Y 14 96317730 G C intron Het probably benign phenotype 05/26/2017
65 478223 UTSW Lrch1 0.000 LCD18 G1 999 Y 14 74905021 C T intron Het probably benign phenotype 05/26/2017
66 478154 UTSW Lrp1b 0.000 LCD18 G1 999 Y 2 42237562 G C intron Het probably benign phenotype 05/26/2017
67 478178 UTSW Lsm8 0.951 LCD18 G1 28.9 Y 6 18844316 G A unclassified Het probably benign phenotype 05/26/2017
68 478179 UTSW Lsm8 0.951 LCD18 G1 999 Y 6 18854321 G A unclassified Het probably benign phenotype 05/26/2017
69 478172 UTSW Magi2 1.000 LCD18 G1 999 Y 5 19954511 T C intron Het probably benign phenotype 05/26/2017
71 478220 UTSW Mef2c 1.000 LCD18 G1 999 Y 13 83605823 G A intron Het probably benign phenotype 05/26/2017
72 478200 UTSW Mei4 0.163 LCD18 G1 999 Y 9 82186959 A G intron Het probably benign phenotype 05/26/2017
73 478248 UTSW Mid1 0.000 LCD18 G1 30.7 Y X 170005564 T A unclassified Het probably benign phenotype 05/26/2017
74 478022 UTSW Mndal 0.126 LCD18 G1 88.6 Y 1 173880218 G C unclassified Het probably benign 05/17/2017
75 478156 UTSW Mpped2 0.000 LCD18 G1 999 Y 2 106721428 C A intron Het probably benign phenotype 05/26/2017
76 478165 UTSW Mtf1 1.000 LCD18 G1 999 Y 4 124829316 A G intron Het probably benign 0.090 phenotype 05/26/2017
77 478182 UTSW Mxd1 0.439 LCD18 G1 999 Y 6 86667406 T C intron Het probably benign phenotype 05/26/2017
78 478159 UTSW Nbea 1.000 LCD18 G1 999 Y 3 55701527 G T intron Het probably benign 0.090 phenotype 05/26/2017
79 484582 UTSW Ncor1 1.000 LCD18 G1 151.81 Y 11 62419782 N critical splice acceptor site Het probably benign phenotype 08/15/2017
80 478188 UTSW Nox4 0.000 LCD18 G1 999 Y 7 87243067 A G unclassified Het probably benign phenotype 05/26/2017
81 478221 UTSW Ocln 0.641 LCD18 G1 999 Y 13 100520567 C T intron Het probably benign phenotype 05/26/2017
82 478217 UTSW Ofcc1 0.000 LCD18 G1 999 Y 13 40092967 G A intron Het probably benign phenotype 05/26/2017
83 478055 UTSW Olfr313 0.087 LCD18 G1 179 Y 11 58817440 V144D T A missense Het possibly damaging 0.797 0.177 phenotype 05/17/2017
84 484578 UTSW Paics 1.000 LCD18 G1 558.1 Y 5 76956744 N frame shift Het probably null 0.976 phenotype 08/15/2017
85 478145 UTSW Paqr8 0.000 LCD18 G1 999 Y 1 20914658 G T intron Het probably benign 05/26/2017
86 478153 UTSW Pdss1 1.000 LCD18 G1 999 Y 2 22900968 C T intron Het probably benign phenotype 05/26/2017
87 478045 UTSW Piezo1 1.000 LCD18 G1 999 Y 8 122495569 R503W G A missense Het probably damaging 1.000 0.265 phenotype 05/17/2017
88 478144 UTSW Pkhd1 0.131 LCD18 G1 999 Y 1 20611414 G A intron Het probably benign phenotype 05/26/2017
89 478070 UTSW Ppp1r3f 0.031 LCD18 G1 999 Y X 7560336 G562V C A missense Het probably damaging 1.000 0.548 phenotype 05/17/2017
90 478238 UTSW Prr16 0.066 LCD18 G1 999 Y 18 51200324 C T intron Het probably benign 05/26/2017
91 478056 UTSW Prss38 0.065 LCD18 G1 999 Y 11 59375641 T G utr 5 prime Het probably benign 05/17/2017
92 478201 UTSW Ptprk 0.000 LCD18 G1 999 Y 10 28574987 T C intron Het probably benign phenotype 05/26/2017
93 484577 UTSW Pum1 0.847 LCD18 G1 280.17 Y 4 130730549 N intron Het probably benign phenotype 08/15/2017
94 484579 UTSW Rabgef1 0.754 LCD18 G1 748.39 Y 5 130187586 N frame shift Het probably null 0.976 phenotype 08/15/2017
95 478151 UTSW Rgs16 0.077 LCD18 G1 999 Y 1 153744230 G A utr 3 prime Het probably benign phenotype 05/26/2017
96 478236 UTSW Riok3 0.268 LCD18 G1 999 Y 18 12129982 G T intron Het probably benign 0.090 phenotype 05/26/2017
97 484583 UTSW Robo2 0.929 LCD18 G1 247.84 Y 16 74055954 N intron Het probably benign phenotype 08/15/2017
98 478247 UTSW Rps6ka3 0.000 LCD18 G1 999 Y X 159279215 A G splice site Het probably benign phenotype 05/26/2017
99 478026 UTSW Rptn 0.090 LCD18 G1 116 Y 3 93397541 L727Q T A missense Het probably benign 0.000 0.090 05/17/2017
100 478237 UTSW Slc25a46 0.000 LCD18 G1 999 Y 18 31597313 C A intron Het probably benign phenotype 05/26/2017
[records 1 to 100 of 114] next >> last >|