Incidental Mutations

130 incidental mutations are currently displayed, and affect 114 genes.
14 are Possibly Damaging.
40 are Probably Damaging.
56 are Probably Benign.
16 are Probably Null.
3 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 130] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 523179 UTSW 1700010B08Rik PIT4131001 G1 182.01 N 2 173719806 C T start gained Het probably benign 06/12/2018
2 523156 UTSW A530032D15Rik 0.348 PIT4131001 G1 210.01 N 1 85099620 A75V G A missense Het probably benign 0.006 06/12/2018
3 523273 UTSW Alpk2 0.000 PIT4131001 G1 225.01 Y 18 65306379 H648Y G A missense Het possibly damaging 0.838 06/12/2018
4 523188 UTSW Ambp 0.131 PIT4131001 G1 225.01 Y 4 63144265 Y246H A G missense Het probably damaging 1.000 phenotype 06/12/2018
5 523201 UTSW Amz1 0.052 PIT4131001 G1 159.01 Y 5 140749333 T C critical splice donor site 2 bp Het probably null 06/12/2018
6 523187 UTSW Anks6 1.000 PIT4131001 G1 189.01 Y 4 47027109 T703I G A missense Het probably damaging 0.996 phenotype 06/12/2018
7 523232 UTSW Armc2 1.000 PIT4131001 G1 50 Y 10 41947887 A G splice site Het probably benign 06/12/2018
8 523217 UTSW Atp7b 0.641 PIT4131001 G1 209.01 Y 8 21994656 I1347F T A missense Het probably damaging 0.999 phenotype 06/12/2018
9 523196 UTSW Atp8a1 0.000 PIT4131001 G1 225.01 Y 5 67622602 W1149* C T nonsense Het probably null phenotype 06/12/2018
10 523250 UTSW Auh 0.000 PIT4131001 G1 201.01 Y 13 52841010 I173T A G missense Het probably damaging 1.000 phenotype 06/12/2018
11 523233 UTSW AW822073 0.068 PIT4131001 G1 85.01 N 10 58223454 C493R A G missense Het probably benign 0.003 06/12/2018
12 523234 UTSW AW822073 0.068 PIT4131001 G1 123.01 N 10 58224314 G A unclassified Het probably benign 06/12/2018
13 523235 UTSW AW822073 0.068 PIT4131001 G1 166.01 N 10 58224882 E17K C T missense Het possibly damaging 0.707 06/12/2018
14 523245 UTSW Axin2 1.000 PIT4131001 G1 225.01 Y 11 108924003 L239P T C missense Het possibly damaging 0.845 phenotype 06/12/2018
15 523274 UTSW Bbs1 0.812 PIT4131001 G1 225.01 Y 19 4899259 F257L A T missense Het possibly damaging 0.830 phenotype 06/12/2018
16 523157 UTSW C130026I21Rik 0.208 PIT4131001 G1 225.01 N 1 85245674 A C intron Het probably benign 06/12/2018
17 523226 UTSW Cacna2d2 0.774 PIT4131001 G1 225.01 Y 9 107524668 P774L C T missense Het probably damaging 0.999 phenotype 06/12/2018
18 523258 UTSW Card6 0.000 PIT4131001 G1 225.01 Y 15 5108306 L22P A G missense Het probably damaging 1.000 phenotype 06/12/2018
19 531241 UTSW Ccdc171 0.171 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
20 523184 UTSW Cdc14a 0.278 PIT4131001 G1 225.01 Y 3 116328661 N219I T A missense Het possibly damaging 0.658 phenotype 06/12/2018
21 523155 UTSW Cfap65 0.528 PIT4131001 G1 225.01 Y 1 74928342 N192K G T missense Het probably benign 0.045 phenotype 06/12/2018
22 523260 UTSW Col14a1 0.000 PIT4131001 G1 50 Y 15 55448876 T C splice site Het probably benign phenotype 06/12/2018
23 523168 UTSW Col5a1 1.000 PIT4131001 G1 225.01 Y 2 28024653 T94A A G missense Het probably benign 0.006 phenotype 06/12/2018
24 523225 UTSW Col6a5 0.904 PIT4131001 G1 225.01 Y 9 105881914 N2031S T C missense Het probably damaging 0.982 phenotype 06/12/2018
25 523227 UTSW Col7a1 1.000 PIT4131001 G1 50 Y 9 108965921 T C splice site Het probably benign phenotype 06/12/2018
26 523231 UTSW Ctgf 1.000 PIT4131001 G1 225.01 Y 10 24596090 V70A T C missense Het probably damaging 0.971 phenotype 06/12/2018
27 523218 UTSW Cyld 0.000 PIT4131001 G1 225.01 Y 8 88746915 S739P T C missense Het probably damaging 0.975 phenotype 06/12/2018
28 523224 UTSW Dbr1 1.000 PIT4131001 G1 225.01 Y 9 99584019 A G unclassified 1970 bp Het probably null phenotype 06/12/2018
29 523263 UTSW Dip2b 0.673 PIT4131001 G1 160.01 Y 15 100202352 L1267P T C missense Het probably damaging 1.000 phenotype 06/12/2018
30 523169 UTSW Dolk 1.000 PIT4131001 G1 225.01 Y 2 30285574 M153T A G missense Het probably benign 0.011 phenotype 06/12/2018
31 523236 UTSW Duxf3 0.052 PIT4131001 G1 186.01 N 10 58231676 S27A A C missense Het probably benign 0.000 06/12/2018
32 523261 UTSW Eef1d 0.229 PIT4131001 G1 112.26 Y 15 75903732 R26H C T missense Homo probably benign 0.009 phenotype 06/12/2018
33 531244 UTSW Efcab5 0.089 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
34 523271 UTSW Epc1 1.000 PIT4131001 G1 225.01 Y 18 6449246 D467G T C missense Het probably damaging 1.000 phenotype 06/12/2018
35 523247 UTSW Fancm 0.845 PIT4131001 G1 225.01 Y 12 65105422 M884R T G missense Het probably benign 0.029 phenotype 06/12/2018
36 523200 UTSW Fbxo24 0.000 PIT4131001 G1 225.01 Y 5 137621902 H15N G T missense Het probably damaging 0.998 phenotype 06/12/2018
37 523189 UTSW Frem1 0.793 PIT4131001 G1 225.01 Y 4 83005808 F305L A G missense Het probably damaging 0.993 phenotype 06/12/2018
38 531240 UTSW Fstl5 0.122 PIT4131001 G1 50 Y 3 76659699 D550G A G missense Het probably damaging 0.994 0.286 08/10/2018
39 523222 UTSW Gcnt3 0.000 PIT4131001 G1 225.01 Y 9 70034044 K414T T G missense Het possibly damaging 0.795 phenotype 06/12/2018
40 523194 UTSW Gm10471 0.070 PIT4131001 G1 109.01 N 5 26086487 F107Y A T missense Het probably benign 0.000 06/12/2018
41 523195 UTSW Gm10471 0.070 PIT4131001 G1 137.01 N 5 26089095 W28C C G missense Het probably damaging 0.998 06/12/2018
42 523221 UTSW Gm10718 0.626 PIT4131001 G1 90.01 N 9 3024417 T134S A T missense Het probably benign 0.006 06/12/2018
43 523219 UTSW Gm10722 0.661 PIT4131001 G1 120.77 N 9 3001414 A G,C unclassified Het probably benign 06/12/2018
44 523174 UTSW Gm10800 0.285 PIT4131001 G1 110.01 N 2 98666548 F220C A C missense Het probably benign 0.114 06/12/2018
45 523175 UTSW Gm10800 0.285 PIT4131001 G1 222 N 2 98666818 R152G T C missense Homo probably benign 0.000 06/12/2018
46 523176 UTSW Gm10800 0.285 PIT4131001 G1 177 N 2 98666905 V123F C A missense Homo probably benign 0.000 06/12/2018
47 523173 UTSW Gm10801 0.641 PIT4131001 G1 125 N 2 98662303 R23G A G missense Homo probably benign 0.000 06/12/2018
48 523220 UTSW Gm11168 PIT4131001 G1 99.18 N 9 3004605 P49S C T missense Het probably benign 0.000 06/12/2018
49 523277 UTSW Gm21677 PIT4131001 G1 80.01 N Y 3297411 H235R T C missense Het probably benign 0.000 06/12/2018
50 523278 UTSW Gm21693 PIT4131001 G1 86.01 N Y 3328944 A241T C T missense Het possibly damaging 0.845 06/12/2018
51 523255 UTSW Gm21738 0.785 PIT4131001 G1 82.01 N 14 19417330 S66L G A missense Het probably benign 0.002 0.090 06/12/2018
52 523276 UTSW Gm4064 PIT4131001 G1 123.01 N Y 2787132 N228Y T A missense Het probably benign 0.000 06/12/2018
53 523166 UTSW Hjurp 0.933 PIT4131001 G1 217.47 N 1 88266278 TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T utr 3 prime Het probably benign 06/12/2018
54 523251 UTSW Hmgcr 1.000 PIT4131001 G1 225.01 Y 13 96659054 Y336H A G missense Het probably damaging 1.000 phenotype 06/12/2018
55 523203 UTSW Hoxa13 1.000 PIT4131001 G1 189.07 N 6 52260647 C G utr 5 prime Homo probably benign phenotype 06/12/2018
56 523204 UTSW Hoxa13 1.000 PIT4131001 G1 187.13 N 6 52260648 G C utr 5 prime Homo probably benign phenotype 06/12/2018
57 523202 UTSW Igf2bp3 0.000 PIT4131001 G1 225.01 Y 6 49117150 A C critical splice donor site 2 bp Het probably null phenotype 06/12/2018
58 523154 UTSW Kcnb2 0.000 PIT4131001 G1 225.01 Y 1 15312976 K175N A T missense Het possibly damaging 0.924 phenotype 06/12/2018
59 523197 UTSW Kdr 1.000 PIT4131001 G1 50 Y 5 75941971 T C splice site Het probably benign phenotype 06/12/2018
60 523170 UTSW Kif5c 0.000 PIT4131001 G1 225.01 Y 2 49694032 K160E A G missense Het probably damaging 0.993 phenotype 06/12/2018
61 531242 UTSW Kif7 1.000 PIT4131001 G1 50 Y 7 79711069 V186E A T missense Het probably damaging 0.999 phenotype 08/10/2018
62 523244 UTSW Krt16 0.072 PIT4131001 G1 50 Y 11 100248749 T48S T A missense Het unknown phenotype 06/12/2018
63 523264 UTSW Liph 0.000 PIT4131001 G1 225.01 Y 16 21995369 M1V T C start codon destroyed Het probably null 0.588 phenotype 06/12/2018
64 523210 UTSW Mctp2 0.129 PIT4131001 G1 225.01 Y 7 72090257 F795S A G missense Het probably damaging 1.000 06/12/2018
65 523265 UTSW Muc4 0.066 PIT4131001 G1 176 N 16 32755676 C G unclassified Homo probably benign phenotype 06/12/2018
66 523266 UTSW Muc4 0.066 PIT4131001 G1 158 N 16 32755684 T A unclassified Homo probably benign phenotype 06/12/2018
67 523267 UTSW Muc4 0.066 PIT4131001 G1 87.03 N 16 32755699 T A unclassified Homo probably benign phenotype 06/12/2018
68 523241 UTSW Myo15 0.000 PIT4131001 G1 225.01 Y 11 60483127 A1267S G T missense Het probably damaging 0.999 phenotype 06/12/2018
69 523242 UTSW Myo15 0.000 PIT4131001 G1 197.01 Y 11 60495454 Y1802H T C missense Het probably damaging 1.000 phenotype 06/12/2018
70 523272 UTSW Myo7b 0.000 PIT4131001 G1 225.01 Y 18 31961206 T1963I G A missense Het probably benign 0.166 phenotype 06/12/2018
71 523259 UTSW Nadk2 1.000 PIT4131001 G1 196.46 N 15 9100143 TG T frame shift Homo probably null phenotype 06/12/2018
72 523252 UTSW Naip5 0.099 PIT4131001 G1 225.01 N 13 100219739 R1123G T C missense Het probably benign 0.000 phenotype 06/12/2018
73 523253 UTSW Naip5 0.099 PIT4131001 G1 175.01 N 13 100219760 N1116D T C missense Het probably benign 0.003 phenotype 06/12/2018
74 523237 UTSW Nap1l1 0.368 PIT4131001 G1 225.01 Y 10 111486722 D61G A G missense Het probably null 0.000 phenotype 06/12/2018
75 523209 UTSW Napsa 0.142 PIT4131001 G1 225.01 Y 7 44581451 T81S A T missense Het probably damaging 0.997 phenotype 06/12/2018
76 523228 UTSW Ngp 0.000 PIT4131001 G1 50 Y 9 110422269 T C unclassified Het probably benign 06/12/2018
77 523229 UTSW Nktr 0.642 PIT4131001 G1 225.01 Y 9 121741621 V143E T A missense Het probably damaging 1.000 phenotype 06/12/2018
78 523240 UTSW Obscn 0.804 PIT4131001 G1 225.01 Y 11 59067064 A G critical splice donor site 2 bp Het probably null phenotype 06/12/2018
79 523172 UTSW Olfr1115 0.060 PIT4131001 G1 225.01 Y 2 87252629 A231T G A missense Het probably benign 0.014 phenotype 06/12/2018
80 523177 UTSW Olfr1305 0.071 PIT4131001 G1 179.01 Y 2 111873304 L184F G A missense Het probably benign 0.021 phenotype 06/12/2018
81 523182 UTSW Olfr266 0.083 PIT4131001 G1 225.01 Y 3 106821966 I198V T C missense Het probably benign 0.001 phenotype 06/12/2018
82 523167 UTSW Olfr414 0.177 PIT4131001 G1 225.01 Y 1 174430824 Y132C A G missense Het probably damaging 1.000 phenotype 06/12/2018
83 523214 UTSW Olfr597 0.065 PIT4131001 G1 225.01 Y 7 103320869 R153* C T nonsense Het probably null phenotype 06/12/2018
84 523215 UTSW Olfr653 0.075 PIT4131001 G1 225.01 Y 7 104580030 R128Q G A missense Het probably damaging 0.990 phenotype 06/12/2018
85 523205 UTSW Paip2b 0.000 PIT4131001 G1 225.01 Y 6 83808841 Y136H A G missense Het probably damaging 1.000 phenotype 06/12/2018
86 531243 UTSW Pde2a 0.860 PIT4131001 G1 50 Y 7 101511154 R845L G T missense Het probably damaging 0.983 phenotype 08/10/2018
87 523213 UTSW Pgap2 1.000 PIT4131001 G1 225.01 Y 7 102237198 Y197C A G missense Het possibly damaging 0.454 06/12/2018
88 523257 UTSW Phf11b 0.156 PIT4131001 G1 50 Y 14 59323162 A G splice site Het probably benign 06/12/2018
89 523199 UTSW Pitpnm2 0.000 PIT4131001 G1 225.01 Y 5 124131115 D481E A T missense Het probably benign 0.006 phenotype 06/12/2018
90 523254 UTSW Pxk 0.360 PIT4131001 G1 193.01 Y 14 8152130 H482L A T missense Het probably benign 0.006 phenotype 06/12/2018
91 523239 UTSW Rad50 1.000 PIT4131001 G1 177.01 N 11 53694899 A G critical splice donor site 2 bp Het probably null phenotype 06/12/2018
92 523190 UTSW Rnf220 0.865 PIT4131001 G1 225.01 Y 4 117277369 A G critical splice donor site 2 bp Het probably null 06/12/2018
93 523181 UTSW Selenbp1 0.000 PIT4131001 G1 225.01 Y 3 94937296 T88M C T missense Het probably damaging 0.988 phenotype 06/12/2018
94 523268 UTSW Sft2d1 0.119 PIT4131001 G1 50 Y 17 8391031 I104T T C missense Het possibly damaging 0.462 06/12/2018
95 523270 UTSW Sik1 0.000 PIT4131001 G1 133.01 Y 17 31851331 S135P A G missense Het probably damaging 1.000 phenotype 06/12/2018
96 523246 UTSW Slc16a3 0.000 PIT4131001 G1 225.01 Y 11 120955346 F34L T C missense Het probably damaging 1.000 phenotype 06/12/2018
97 523230 UTSW Slc6a20b 0.000 PIT4131001 G1 120.07 N 9 123612126 N85S T C missense Homo probably benign 0.001 06/12/2018
98 523206 UTSW Snrnp27 1.000 PIT4131001 G1 225.01 Y 6 86682911 R34G T C missense Het unknown phenotype 06/12/2018
99 523249 UTSW Sos2 0.000 PIT4131001 G1 225.01 Y 12 69618077 H393R T C missense Het probably benign 0.000 phenotype 06/12/2018
100 523158 UTSW Sp110 0.442 PIT4131001 G1 92.01 N 1 85586250 R262Q C T missense Het probably benign 0.053 06/12/2018
[records 1 to 100 of 130] next >> last >|