Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
6 are Possibly Damaging.
20 are Probably Damaging.
15 are Probably Benign.
3 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 555543 UTSW 1700129C05Rik 0.077 PIT4402001 G1 188.01 N 14 59142635 L71F T G missense Het probably damaging 0.993 06/07/2019
2 555519 UTSW Adamts9 1.000 PIT4402001 G1 137.01 N 6 92872347 V1044I C T missense Het probably benign 0.000 phenotype 06/07/2019
3 555548 UTSW Alcam 0.341 PIT4402001 G1 225.01 N 16 52295134 Y207C T C missense Het probably damaging 0.997 phenotype 06/07/2019
4 555514 UTSW Aldh4a1 0.087 PIT4402001 G1 136.01 N 4 139642191 S351* C A nonsense Het probably null phenotype 06/07/2019
5 555542 UTSW Aoah 0.000 PIT4402001 G1 200.01 N 13 20794510 S39R C A missense Het probably benign 0.003 phenotype 06/07/2019
6 555527 UTSW Arcn1 0.000 PIT4402001 G1 225.01 N 9 44745602 V421E A T missense Het possibly damaging 0.887 phenotype 06/07/2019
7 555517 UTSW Ccdc18 0.000 PIT4402001 G1 225.01 N 5 108158619 E300G A G missense Het possibly damaging 0.936 06/07/2019
8 555549 UTSW Cdk2ap2 0.000 PIT4402001 G1 225.01 N 19 4098557 R126S C A missense Het probably damaging 0.981 phenotype 06/07/2019
9 555516 UTSW Dcun1d4 0.224 PIT4402001 G1 225.01 N 5 73510933 I39V A G missense Het probably benign 0.088 06/07/2019
10 555524 UTSW Fam53b 0.000 PIT4402001 G1 154.01 N 7 132760017 I94N A T missense Het probably damaging 1.000 06/07/2019
11 555538 UTSW Fam83g 0.113 PIT4402001 G1 171.01 N 11 61703596 H652R A G missense Het probably damaging 0.991 phenotype 06/07/2019
12 555526 UTSW Fanca 0.699 PIT4402001 G1 225.01 N 8 123313064 M157K A T missense Het possibly damaging 0.831 phenotype 06/07/2019
13 555518 UTSW Flt1 1.000 PIT4402001 G1 225.01 N 5 147678239 I299N A T missense Het probably damaging 1.000 phenotype 06/07/2019
14 555510 UTSW Gm10800 0.285 PIT4402001 G1 125.46 N 2 98667016 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA frame shift Het probably null 06/07/2019
15 555533 UTSW Gns 0.237 PIT4402001 G1 225.01 N 10 121376706 Y191C A G missense Het probably damaging 1.000 phenotype 06/07/2019
16 555545 UTSW Grin2a 0.468 PIT4402001 G1 225.01 N 16 9644199 T690A T C missense Het possibly damaging 0.768 phenotype 06/07/2019
17 555547 UTSW Gsk3b 0.924 PIT4402001 G1 97.01 N 16 38089401 C T unclassified Het probably benign phenotype 06/07/2019
18 555511 UTSW Igsf10 0.179 PIT4402001 G1 225.01 N 3 59325579 V1911A A G missense Het probably benign 0.001 06/07/2019
19 555512 UTSW Igsf3 0.204 PIT4402001 G1 182.01 N 3 101427077 K157E A G missense Het probably benign 0.005 phenotype 06/07/2019
20 555525 UTSW Inpp5a 1.000 PIT4402001 G1 225.01 N 7 139511453 Y118H T C missense Het probably benign 0.016 phenotype 06/07/2019
21 555528 UTSW Kmt2a 1.000 PIT4402001 G1 162.01 N 9 44841062 V1413A A G missense Het unknown phenotype 06/07/2019
22 555523 UTSW Mettl9 0.156 PIT4402001 G1 103.01 N 7 121057217 V190E T A missense Het probably damaging 0.987 06/07/2019
23 555506 UTSW Mrps9 0.933 PIT4402001 G1 195.01 N 1 42896098 L188P T C missense Het probably benign 0.096 phenotype 06/07/2019
24 555529 UTSW Myo9a 0.000 PIT4402001 G1 161.01 N 9 59870436 R1158S A T missense Het possibly damaging 0.835 phenotype 06/07/2019
25 555535 UTSW Nacad 0.000 PIT4402001 G1 225.01 N 11 6598621 Q1371P T G missense Het probably benign 0.190 06/07/2019
26 555539 UTSW Ncoa1 0.000 PIT4402001 G1 225.01 N 12 4294987 M787V T C missense Het probably benign 0.003 phenotype 06/07/2019
27 555540 UTSW Noxred1 0.065 PIT4402001 G1 225.01 N 12 87227081 I62K A T missense Het probably benign 0.005 06/07/2019
28 555537 UTSW Olfr1390 0.086 PIT4402001 G1 225.01 N 11 49341399 Y289C A G missense Het probably damaging 1.000 phenotype 06/07/2019
29 555522 UTSW Olfr1532-ps1 0.090 PIT4402001 G1 208.01 N 7 106915087 D296E T A missense Het possibly damaging 0.494 phenotype 06/07/2019
30 555509 UTSW Olfr350 0.262 PIT4402001 G1 225.01 N 2 36850304 H86L A T missense Het probably benign 0.000 phenotype 06/07/2019
31 555521 UTSW Olfr646 0.614 PIT4402001 G1 143.01 N 7 104106450 Y57C A G missense Het probably damaging 1.000 phenotype 06/07/2019
32 555513 UTSW Otud6b 0.123 PIT4402001 G1 225.01 N 4 14818185 Y239H A G missense Het probably damaging 0.991 phenotype 06/07/2019
33 555551 UTSW Pank1 0.141 PIT4402001 G1 225.01 N 19 34840966 Y233H A G missense Het probably damaging 0.999 phenotype 06/07/2019
34 555530 UTSW Pccb 1.000 PIT4402001 G1 136.01 N 9 100995592 D286E G T missense Het probably benign 0.011 phenotype 06/07/2019
35 555536 UTSW Plek 0.196 PIT4402001 G1 198.01 N 11 16990121 L196R A C missense Het probably benign 0.000 phenotype 06/07/2019
36 555541 UTSW Pou6f2 0.000 PIT4402001 G1 225.01 N 13 18125346 H576R T C missense Het phenotype 06/07/2019
37 555515 UTSW Rbm47 0.252 PIT4402001 G1 225.01 N 5 66027011 Y83F T A missense Het probably damaging 0.999 phenotype 06/07/2019
38 555531 UTSW Rbm6 0.876 PIT4402001 G1 225.01 N 9 107787850 Y787N A T missense Het probably damaging 0.997 06/07/2019
39 555520 UTSW Slc8a2 0.148 PIT4402001 G1 179.01 N 7 16134494 A217E C A missense Het probably damaging 0.996 phenotype 06/07/2019
40 555534 UTSW Suox 0.497 PIT4402001 G1 225.01 N 10 128671295 A288V G A missense Het probably damaging 1.000 phenotype 06/07/2019
41 555546 UTSW Tbccd1 0.000 PIT4402001 G1 225.01 N 16 22822123 I501M T C missense Het probably damaging 0.998 06/07/2019
42 555550 UTSW Tjp2 1.000 PIT4402001 G1 192.01 N 19 24098129 G1042* C A nonsense Het probably null phenotype 06/07/2019
43 555532 UTSW Tmtc2 0.168 PIT4402001 G1 156.01 N 10 105413407 Y155C T C missense Het probably damaging 1.000 phenotype 06/07/2019
44 555544 UTSW Usp7 1.000 PIT4402001 G1 162.01 N 16 8698495 N600S T C missense Het probably benign 0.000 phenotype 06/07/2019
45 555508 UTSW Zer1 0.324 PIT4402001 G1 202.01 N 2 30101120 I699V T C missense Het probably damaging 0.960 phenotype 06/07/2019
46 555507 UTSW Zfp142 0.000 PIT4402001 G1 130.01 N 1 74579528 F227S A G missense Het probably damaging 0.996 phenotype 06/07/2019
[records 1 to 46 of 46]