Incidental Mutations

59 incidental mutations are currently displayed, and affect 59 genes.
11 are Possibly Damaging.
19 are Probably Damaging.
21 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 59 of 59] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 554872 UTSW 4932415D10Rik 0.116 PIT4480001 G1 225.01 N 10 82283752 M4475V T C missense Het probably benign 0.062 06/07/2019
2 554895 UTSW Actn3 0.411 PIT4480001 G1 225.01 N 19 4867577 Q413* G A nonsense Het probably null phenotype 06/07/2019
3 554879 UTSW Ahnak2 0.087 PIT4480001 G1 225.01 N 12 112773924 S1238N C T missense Het possibly damaging 0.787 06/07/2019
4 554883 UTSW Arsk 0.000 PIT4480001 G1 225.01 N 13 76062365 E521G T C missense Het probably damaging 0.997 phenotype 06/07/2019
5 554877 UTSW Baiap2 0.215 PIT4480001 G1 93.01 N 11 119997087 T356A A G missense Het probably benign 0.000 phenotype 06/07/2019
6 554853 UTSW Baz1b 1.000 PIT4480001 G1 225.01 N 5 135217965 R756H G A missense Het probably damaging 1.000 phenotype 06/07/2019
7 554888 UTSW Celsr1 0.823 PIT4480001 G1 225.01 N 15 86032414 P453S G A missense Het probably damaging 0.992 phenotype 06/07/2019
8 554855 UTSW Cep41 0.000 PIT4480001 G1 225.01 N 6 30658413 P196S G A missense Het probably damaging 1.000 phenotype 06/07/2019
9 554885 UTSW Cln5 0.251 PIT4480001 G1 106.01 N 14 103071778 Y89* T A nonsense Het probably null phenotype 06/07/2019
10 554882 UTSW Cntnap3 0.066 PIT4480001 G1 145.01 N 13 64757210 F919S A G missense Het probably damaging 1.000 phenotype 06/07/2019
11 554844 UTSW Cntrl 0.812 PIT4480001 G1 225.01 N 2 35155428 H1383Y C T missense Het probably damaging 0.960 phenotype 06/07/2019
12 554873 UTSW Cobl 0.000 PIT4480001 G1 225.01 N 11 12253592 S1037P A G missense Het probably benign 0.000 phenotype 06/07/2019
13 554898 UTSW Col17a1 0.000 PIT4480001 G1 150.01 N 19 47671374 S380T A T missense Het probably benign 0.051 phenotype 06/07/2019
14 554897 UTSW Dagla 0.000 PIT4480001 G1 110.01 N 19 10260658 S323T A T missense Het probably benign 0.021 phenotype 06/07/2019
15 554878 UTSW Dicer1 1.000 PIT4480001 G1 161.01 N 12 104696544 Q1593K G T missense Het probably benign 0.000 phenotype 06/07/2019
16 554856 UTSW Dnah6 0.110 PIT4480001 G1 157.01 N 6 73101880 I2367V T C missense Het probably benign 0.004 phenotype 06/07/2019
17 554850 UTSW Emc1 0.962 PIT4480001 G1 225.01 N 4 139359277 S184P T C missense Het possibly damaging 0.689 phenotype 06/07/2019
18 554860 UTSW Eps8l1 0.000 PIT4480001 G1 222 N 7 4471415 S295N G A missense Het probably benign 0.004 0.090 phenotype 06/07/2019
19 554841 UTSW Erbb4 1.000 PIT4480001 G1 225.01 N 1 68075543 M914K A T missense Het probably damaging 1.000 phenotype 06/07/2019
20 554857 UTSW Eva1a 0.213 PIT4480001 G1 225.01 N 6 82091803 E37G A G missense Het probably damaging 1.000 06/07/2019
21 554887 UTSW Fam49b 0.000 PIT4480001 G1 225.01 N 15 63956641 T11I G A missense Het probably benign 0.423 06/07/2019
22 554869 UTSW Fyco1 0.000 PIT4480001 G1 121.01 N 9 123828650 Y820* G T nonsense Het probably null phenotype 06/07/2019
23 554861 UTSW Gipr 0.078 PIT4480001 G1 225.01 N 7 19162934 Y137C T C missense Het probably damaging 1.000 phenotype 06/07/2019
24 554889 UTSW Gm5414 0.132 PIT4480001 G1 225.01 N 15 101627746 V148A A G missense Het probably damaging 0.998 06/07/2019
25 554852 UTSW Gpn1 0.962 PIT4480001 G1 225.01 N 5 31497341 V79A T C missense Het probably damaging 0.999 phenotype 06/07/2019
26 554894 UTSW Grk2 1.000 PIT4480001 G1 225.01 N 19 4287409 R617C G A missense Het possibly damaging 0.928 phenotype 06/07/2019
27 554864 UTSW Inpp4b 0.475 PIT4480001 G1 225.01 N 8 82046267 E730A A C missense Het probably damaging 0.999 phenotype 06/07/2019
28 554863 UTSW Inpp5f 0.283 PIT4480001 G1 225.01 N 7 128685134 T579I C T missense Het probably benign 0.316 phenotype 06/07/2019
29 554868 UTSW Kif15 0.000 PIT4480001 G1 225.01 N 9 123011543 M1201L A T missense Het probably benign 0.000 06/07/2019
30 554896 UTSW Ltbp3 0.274 PIT4480001 G1 165.01 N 19 5751226 N631S A G missense Het possibly damaging 0.732 phenotype 06/07/2019
31 554874 UTSW Mdh1 1.000 PIT4480001 G1 225.01 N 11 21558538 S268L G A missense Het probably damaging 1.000 phenotype 06/07/2019
32 554843 UTSW Mgat4e 0.082 PIT4480001 G1 225.01 N 1 134541365 T314S T A missense Het possibly damaging 0.568 06/07/2019
33 554881 UTSW Nsd1 1.000 PIT4480001 G1 190.01 N 13 55213918 Q233R A G missense Het probably benign 0.108 phenotype 06/07/2019
34 554845 UTSW Olfr1141 0.097 PIT4480001 G1 225.01 N 2 87753783 D70G T C missense Het possibly damaging 0.954 phenotype 06/07/2019
35 554884 UTSW Olfr738 0.077 PIT4480001 G1 225.01 N 14 50413915 F124L T C missense Het probably benign 0.135 phenotype 06/07/2019
36 554866 UTSW Paqr5 0.109 PIT4480001 G1 225.01 N 9 61956156 I295L T A missense Het probably benign 0.085 06/07/2019
37 554854 UTSW Peg10 1.000 PIT4480001 G1 138.02 N 6 4756560 H379Y C T missense Het unknown phenotype 06/07/2019
38 554851 UTSW Phtf2 0.000 PIT4480001 G1 225.01 N 5 20813244 I33N A T missense Het probably damaging 0.998 06/07/2019
39 554846 UTSW Plcb2 0.000 PIT4480001 G1 225.01 N 2 118723496 M115V T C missense Het probably benign 0.001 phenotype 06/07/2019
40 554867 UTSW Ppp2r3a 0.000 PIT4480001 G1 225.01 N 9 101126377 Y431H A G missense Het possibly damaging 0.948 phenotype 06/07/2019
41 554893 UTSW Prph2 0.000 PIT4480001 G1 184.47 N 17 46911113 GT G frame shift Het probably null phenotype 06/07/2019
42 554842 UTSW Psmd1 0.966 PIT4480001 G1 225.01 N 1 86128238 P774L C T missense Het probably damaging 0.987 phenotype 06/07/2019
43 554875 UTSW Ranbp17 0.000 PIT4480001 G1 171.01 N 11 33297340 A T critical splice donor site 2 bp Het probably null phenotype 06/07/2019
44 554848 UTSW Rptn 0.101 PIT4480001 G1 225.01 N 3 93397670 D770G A G missense Het possibly damaging 0.845 06/07/2019
45 554891 UTSW Serac1 0.000 PIT4480001 G1 225.01 N 17 6050812 L439P A G missense Het probably damaging 1.000 phenotype 06/07/2019
46 554886 UTSW Slitrk6 0.167 PIT4480001 G1 160.47 N 14 110749825 TTTTAGTCTGTTCTACCAACACCTT TTT frame shift Het probably null phenotype 06/07/2019
47 554862 UTSW Sox6 1.000 PIT4480001 G1 147.01 N 7 115597509 I295M T C missense Het probably benign 0.028 phenotype 06/07/2019
48 554840 UTSW Sulf1 0.608 PIT4480001 G1 214.01 N 1 12859413 D301E T A missense Het probably benign 0.009 phenotype 06/07/2019
49 554859 UTSW Tas2r117 0.062 PIT4480001 G1 225.01 N 6 132803051 V51I G A missense Het possibly damaging 0.911 06/07/2019
50 554876 UTSW Tbx2 1.000 PIT4480001 G1 172.01 N 11 85834735 R171C C T missense Het probably damaging 1.000 phenotype 06/07/2019
51 554849 UTSW Tgfbr1 1.000 PIT4480001 G1 180.01 N 4 47402955 I320V A G missense Het probably benign 0.439 phenotype 06/07/2019
52 554871 UTSW Tjp3 0.000 PIT4480001 G1 91.01 N 10 81279257 G396W C A missense Het probably damaging 1.000 phenotype 06/07/2019
53 554890 UTSW Tmprss2 0.000 PIT4480001 G1 225.01 N 16 97599260 N4D T C missense Het possibly damaging 0.771 phenotype 06/07/2019
54 554870 UTSW Tnfaip3 0.000 PIT4480001 G1 225.01 N 10 19007323 N165D T C missense Het probably benign 0.000 phenotype 06/07/2019
55 554892 UTSW Tnfrsf21 0.126 PIT4480001 G1 225.01 N 17 43037911 Y138F A T missense Het probably benign 0.001 phenotype 06/07/2019
56 554865 UTSW Utp4 1.000 PIT4480001 G1 225.01 N 8 106906185 S267P T C missense Het probably benign 0.001 phenotype 06/07/2019
57 554858 UTSW Wnk1 1.000 PIT4480001 G1 164.01 N 6 119963367 L803* A T nonsense Het probably null phenotype 06/07/2019
58 554847 UTSW Zbbx 0.060 PIT4480001 G1 225.01 N 3 75136487 D35V T A missense Het probably damaging 1.000 06/07/2019
59 554880 UTSW Zscan12 0.000 PIT4480001 G1 173.01 N 13 21368574 N189K T G missense Het possibly damaging 0.719 06/07/2019
[records 1 to 59 of 59]