Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
9 are Possibly Damaging.
23 are Probably Damaging.
13 are Probably Benign.
4 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 556098 UTSW 1700018F24Rik 0.049 PIT4486001 G1 225.01 N 5 145044104 S108P T C missense Het probably damaging 0.996 06/07/2019
2 556095 UTSW 4930548H24Rik 0.053 PIT4486001 G1 135.01 N 5 31487743 I280K T A missense Het probably damaging 0.989 06/07/2019
3 556083 UTSW 4931408C20Rik 0.000 PIT4486001 G1 225.01 N 1 26685329 P257S G A missense Het probably damaging 0.990 06/07/2019
4 556089 UTSW Abhd16b 0.074 PIT4486001 G1 147.01 N 2 181493959 Q218L A T missense Het probably benign 0.388 06/07/2019
5 556132 UTSW Abhd3 0.492 PIT4486001 G1 225.01 N 18 10645233 I354F T A missense Het probably benign 0.232 phenotype 06/07/2019
6 556123 UTSW Abt1 0.965 PIT4486001 G1 165.01 N 13 23423681 Y51C T C missense Het possibly damaging 0.871 phenotype 06/07/2019
7 556131 UTSW Actl9 0.000 PIT4486001 G1 181.01 N 17 33434198 Y411N T A missense Het possibly damaging 0.949 06/07/2019
8 556111 UTSW Ano4 0.000 PIT4486001 G1 184.01 N 10 88993029 V516A A G missense Het probably damaging 1.000 06/07/2019
9 556118 UTSW Bptf 1.000 PIT4486001 G1 225.01 N 11 107054788 S2542T A T missense Het probably damaging 0.976 phenotype 06/07/2019
10 556097 UTSW Card11 0.000 PIT4486001 G1 177.01 N 5 140876408 V1045M C T missense Het probably damaging 1.000 phenotype 06/07/2019
11 556119 UTSW Cd300ld2 0.000 PIT4486001 G1 132.46 N 11 115012431 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG small deletion Het probably benign 06/07/2019
12 556104 UTSW Cdh3 0.109 PIT4486001 G1 183.01 N 8 106541490 K386E A G missense Het possibly damaging 0.888 phenotype 06/07/2019
13 556091 UTSW Cks1b PIT4486001 G1 225.01 N 3 89416314 Q49H C A missense Het probably damaging 1.000 phenotype 06/07/2019
14 556102 UTSW Clpb 0.878 PIT4486001 G1 140.01 N 7 101663932 D41V A T missense Het probably benign 0.170 phenotype 06/07/2019
15 556099 UTSW Cyp3a11 0.000 PIT4486001 G1 225.01 N 5 145860492 M359K A T missense Het probably damaging 0.991 06/07/2019
16 556096 UTSW Cyp3a13 0.000 PIT4486001 G1 225.01 N 5 137909966 I207N A T missense Het probably benign 0.175 phenotype 06/07/2019
17 556093 UTSW Dennd4c 1.000 PIT4486001 G1 225.01 N 4 86799464 L566* T A nonsense Het probably null 06/07/2019
18 556087 UTSW Dhtkd1 0.000 PIT4486001 G1 225.01 N 2 5899995 D859E A T missense Het probably benign 0.000 phenotype 06/07/2019
19 556129 UTSW Efcab6 0.000 PIT4486001 G1 225.01 N 15 83973313 D295G T C missense Het probably benign 0.001 phenotype 06/07/2019
20 556101 UTSW Fcgbp 0.000 PIT4486001 G1 225.01 N 7 28075273 T91A A G missense Het possibly damaging 0.525 06/07/2019
21 556116 UTSW Gm11569 PIT4486001 G1 108.47 N 11 99798665 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA small deletion Het probably benign 06/07/2019
22 556117 UTSW Gm884 0.205 PIT4486001 G1 225.01 N 11 103618201 H980Q A T missense Het unknown 06/07/2019
23 556113 UTSW Gsdma3 0.084 PIT4486001 G1 225.01 N 11 98638054 K454E A G missense Het unknown phenotype 06/07/2019
24 556107 UTSW Herc1 0.000 PIT4486001 G1 225.01 N 9 66372389 I193N T A missense Het probably damaging 0.997 phenotype 06/07/2019
25 556084 UTSW Kdm5b 0.290 PIT4486001 G1 184.01 N 1 134628685 L1370Q T A missense Het probably damaging 1.000 phenotype 06/07/2019
26 556109 UTSW Map4 0.000 PIT4486001 G1 225.01 N 9 110072614 V965G T G missense Het probably damaging 1.000 phenotype 06/07/2019
27 556100 UTSW Mkrn2os 0.078 PIT4486001 G1 143.01 N 6 115585483 D173G T C missense Het probably benign 0.006 06/07/2019
28 556126 UTSW Ndfip2 0.000 PIT4486001 G1 225.01 N 14 105294866 D232G A G missense Het probably damaging 1.000 phenotype 06/07/2019
29 556127 UTSW Nipal2 0.053 PIT4486001 G1 225.01 N 15 34584729 G231D C T missense Het probably damaging 0.991 06/07/2019
30 556130 UTSW Notch3 0.000 PIT4486001 G1 225.01 N 17 32154763 N490K A T missense Het probably damaging 1.000 0.850 phenotype 06/07/2019
31 556105 UTSW Olfr150 0.125 PIT4486001 G1 225.01 N 9 39737239 C141* T A nonsense Het probably null phenotype 06/07/2019
32 556103 UTSW Olfr493 0.103 PIT4486001 G1 225.01 N 7 108346322 S220P A G missense Het possibly damaging 0.946 phenotype 06/07/2019
33 556108 UTSW Prkar2a 0.000 PIT4486001 G1 225.01 N 9 108733127 L185S T C missense Het probably damaging 0.996 phenotype 06/07/2019
34 556106 UTSW Ptpn9 0.498 PIT4486001 G1 225.01 N 9 57061003 N542K T G missense Het probably damaging 0.992 phenotype 06/07/2019
35 556112 UTSW Pus10 0.000 PIT4486001 G1 189.01 N 11 23712326 G A critical splice donor site 1 bp Het probably null phenotype 06/07/2019
36 556134 UTSW Pyroxd2 0.076 PIT4486001 G1 148.01 N 19 42740389 S191P A G missense Het probably benign 0.004 06/07/2019
37 556122 UTSW Rab15 0.000 PIT4486001 G1 225.01 N 12 76801942 K122* T A nonsense Het probably null 06/07/2019
38 556114 UTSW Rara 1.000 PIT4486001 G1 138.01 N 11 98973495 N416S A G missense Het possibly damaging 0.880 phenotype 06/07/2019
39 556128 UTSW Rims2 0.572 PIT4486001 G1 225.01 N 15 39476520 V870A T C missense Het possibly damaging 0.668 phenotype 06/07/2019
40 556088 UTSW Sec16a 0.960 PIT4486001 G1 148.01 N 2 26425773 T293A T C missense Het phenotype 06/07/2019
41 556121 UTSW Slc26a3 0.810 PIT4486001 G1 225.01 N 12 31470950 D718N G A missense Het probably benign 0.012 phenotype 06/07/2019
42 556092 UTSW Slc44a5 0.077 PIT4486001 G1 221.01 N 3 154259022 V520I G A missense Het possibly damaging 0.497 06/07/2019
43 556086 UTSW Tgfb2 1.000 PIT4486001 G1 129.01 N 1 186690727 Y142N A T missense Het probably benign 0.042 phenotype 06/07/2019
44 556125 UTSW Tgfbi 0.110 PIT4486001 G1 172.01 N 13 56629794 I364F A T missense Het probably damaging 0.984 phenotype 06/07/2019
45 556090 UTSW Tmem144 0.077 PIT4486001 G1 202.01 N 3 79826867 D176E A C missense Het probably benign 0.001 06/07/2019
46 556115 UTSW Tns4 0.398 PIT4486001 G1 225.01 N 11 99071335 L612Q A T missense Het probably damaging 1.000 06/07/2019
47 556094 UTSW Toe1 1.000 PIT4486001 G1 225.01 N 4 116806495 L76S A G missense Het probably damaging 1.000 06/07/2019
48 556110 UTSW Trank1 0.000 PIT4486001 G1 225.01 N 9 111390107 F1971L T C missense Het probably damaging 1.000 06/07/2019
49 556120 UTSW Tsen54 0.956 PIT4486001 G1 225.01 N 11 115822596 V481F G T missense Het probably damaging 0.999 phenotype 06/07/2019
50 556124 UTSW Uimc1 0.208 PIT4486001 G1 225.01 N 13 55075568 L297P A G missense Het probably damaging 0.993 phenotype 06/07/2019
51 556133 UTSW Wnt8a 0.000 PIT4486001 G1 118.01 N 18 34547583 Y334H T C missense Het probably damaging 1.000 phenotype 06/07/2019
52 556085 UTSW Zfp281 1.000 PIT4486001 G1 225.01 N 1 136627003 D573G A G missense Het possibly damaging 0.482 phenotype 06/07/2019
[records 1 to 52 of 52]