Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
8 are Possibly Damaging.
13 are Probably Damaging.
16 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 556179 UTSW Adh1 0.000 PIT4687001 G1 225.01 N 3 138289835 V333G T G missense Het probably damaging 1.000 phenotype 06/07/2019
2 556202 UTSW Aggf1 0.437 PIT4687001 G1 225.01 N 13 95364875 L333P A G missense Het probably damaging 0.986 phenotype 06/07/2019
3 556174 UTSW Ankmy1 0.087 PIT4687001 G1 200.01 N 1 92885081 V502A A G missense Het probably benign 0.001 06/07/2019
4 556193 UTSW Atm 0.820 PIT4687001 G1 154.01 N 9 53486812 A G critical splice donor site 2 bp Het probably null phenotype 06/07/2019
5 556181 UTSW Ccdc180 0.000 PIT4687001 G1 225.01 N 4 45949526 T1594A A G missense Het probably damaging 0.995 phenotype 06/07/2019
6 556197 UTSW Cep290 0.941 PIT4687001 G1 225.01 N 10 100537591 D1244E T A missense Het probably benign 0.276 phenotype 06/07/2019
7 556196 UTSW Ctnna3 0.164 PIT4687001 G1 225.01 N 10 64834606 D638G A G missense Het probably damaging 0.999 phenotype 06/07/2019
8 556200 UTSW Ctsr 0.103 PIT4687001 G1 225.01 N 13 61160532 H266R T C missense Het possibly damaging 0.516 06/07/2019
9 556185 UTSW D630045J12Rik 0.000 PIT4687001 G1 225.01 N 6 38195101 E711K C T missense Het probably benign 0.000 phenotype 06/07/2019
10 556204 UTSW Dnah5 0.641 PIT4687001 G1 225.01 N 15 28383577 S2982P T C missense Het probably damaging 0.984 phenotype 06/07/2019
11 556210 UTSW Dsg1a 0.107 PIT4687001 G1 225.01 N 18 20331698 A417S G T missense Het probably benign 0.160 phenotype 06/07/2019
12 556198 UTSW Gdpd1 0.108 PIT4687001 G1 225.01 N 11 87059540 D69G T C missense Het probably damaging 0.999 phenotype 06/07/2019
13 556184 UTSW Gm13103 0.074 PIT4687001 G1 225.01 N 4 143846533 C T start gained Het probably benign 06/07/2019
14 556188 UTSW Gp2 0.000 PIT4687001 G1 225.01 N 7 119451578 R310H C T missense Het possibly damaging 0.480 phenotype 06/07/2019
15 556182 UTSW Ifna2 0.058 PIT4687001 G1 225.01 N 4 88683305 H159Y G A missense Het possibly damaging 0.919 06/07/2019
16 556186 UTSW Kptn 0.000 PIT4687001 G1 225.01 N 7 16125826 V325A T C missense Het probably damaging 0.962 phenotype 06/07/2019
17 556176 UTSW March7 0.321 PIT4687001 G1 225.01 N 2 60232278 E143G A G missense Het probably damaging 1.000 phenotype 06/07/2019
18 556206 UTSW Mcm4 1.000 PIT4687001 G1 225.01 N 16 15636713 L47P A G missense Het probably benign 0.015 phenotype 06/07/2019
19 556178 UTSW Mcm8 0.555 PIT4687001 G1 225.01 N 2 132817177 F27S T C missense Het possibly damaging 0.539 phenotype 06/07/2019
20 556191 UTSW Nod2 0.248 PIT4687001 G1 225.01 N 8 88681646 V967E T A missense Het probably damaging 0.997 phenotype 06/07/2019
21 556211 UTSW Nrxn2 0.000 PIT4687001 G1 225.01 N 19 6481308 R659Q G A missense Het probably benign 0.063 phenotype 06/07/2019
22 556207 UTSW Olfr120 0.070 PIT4687001 G1 225.01 N 17 37726191 C56G T G missense Het probably benign 0.013 phenotype 06/07/2019
23 556177 UTSW Olfr1267-ps1 0.372 PIT4687001 G1 225.01 N 2 90086389 V24A A G missense Het probably benign 0.021 06/07/2019
24 556205 UTSW Parp10 0.098 PIT4687001 G1 107.01 N 15 76240922 R545Q C T missense Het probably benign 0.005 phenotype 06/07/2019
25 556194 UTSW Ppp2r3a 0.000 PIT4687001 G1 219.01 N 9 101144380 E332G T C missense Het probably benign 0.004 phenotype 06/07/2019
26 556199 UTSW Ptpdc1 0.000 PIT4687001 G1 114.01 N 13 48586290 V555A A G missense Het probably benign 0.153 phenotype 06/07/2019
27 556175 UTSW Qsox2 0.078 PIT4687001 G1 225.01 N 2 26222288 L81F G A missense Het possibly damaging 0.927 phenotype 06/07/2019
28 556187 UTSW Sbsn 0.057 PIT4687001 G1 173.49 N 7 30752966 GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA intron Het probably benign 06/07/2019
29 556201 UTSW Spata31 0.203 PIT4687001 G1 225.01 N 13 64921337 D433G A G missense Het probably benign 0.017 06/07/2019
30 556180 UTSW Stpg2 0.057 PIT4687001 G1 86.01 N 3 139215265 I77T T C missense Het possibly damaging 0.891 06/07/2019
31 556190 UTSW Sugp2 0.122 PIT4687001 G1 90.01 N 8 70257512 S928P T C missense Het probably damaging 0.965 phenotype 06/07/2019
32 556195 UTSW Syne1 1.000 PIT4687001 G1 225.01 N 10 5358390 S722P A G missense Het possibly damaging 0.867 phenotype 06/07/2019
33 556183 UTSW Szt2 0.519 PIT4687001 G1 140.01 N 4 118398201 S229T A T missense Het possibly damaging 0.841 phenotype 06/07/2019
34 556212 UTSW Tm9sf3 1.000 PIT4687001 G1 178.01 N 19 41218191 L505P A G missense Het probably damaging 1.000 06/07/2019
35 556209 UTSW Ttc39d 0.149 PIT4687001 G1 225.01 N 17 80216925 A338T G A missense Het probably damaging 1.000 06/07/2019
36 556192 UTSW Ubash3b 0.196 PIT4687001 G1 225.01 N 9 41023518 F489L A G missense Het probably damaging 1.000 phenotype 06/07/2019
37 556203 UTSW Xpo7 0.250 PIT4687001 G1 225.01 N 14 70667149 Y1015N A T missense Het probably benign 0.220 phenotype 06/07/2019
38 556208 UTSW Zbtb14 0.909 PIT4687001 G1 225.01 N 17 69388307 Y333* C A nonsense Het probably null phenotype 06/07/2019
39 556189 UTSW Zp2 0.071 PIT4687001 G1 218.01 N 7 120141879 T141A T C missense Het probably benign 0.002 phenotype 06/07/2019
[records 1 to 39 of 39]