Incidental Mutations

62 incidental mutations are currently displayed, and affect 62 genes.
12 are Possibly Damaging.
22 are Probably Damaging.
21 are Probably Benign.
5 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 556947 UTSW 4921524L21Rik 0.093 PIT4812001 G1 225.01 N 18 6630053 S252P T C missense Het possibly damaging 0.930 06/07/2019
2 556895 UTSW 4933409G03Rik 0.074 PIT4812001 G1 225.01 N 2 68588948 V14I G A missense Het probably benign 0.160 06/07/2019
3 556945 UTSW Adgrf5 0.000 PIT4812001 G1 225.01 N 17 43450369 V985G T G missense Het probably damaging 0.999 phenotype 06/07/2019
4 556888 UTSW Ankrd44 0.158 PIT4812001 G1 225.01 N 1 54723038 Y542* A T nonsense Het probably null 06/07/2019
5 556941 UTSW Atp13a3 0.516 PIT4812001 G1 150.01 N 16 30362578 T75A T C missense Het probably damaging 0.977 phenotype 06/07/2019
6 556917 UTSW Atr 1.000 PIT4812001 G1 215.01 N 9 95910649 F1675L T C missense Het probably benign 0.412 phenotype 06/07/2019
7 556949 UTSW Atrnl1 0.230 PIT4812001 G1 225.01 N 19 57731623 I1082V A G missense Het probably benign 0.078 phenotype 06/07/2019
8 556901 UTSW C87977 0.101 PIT4812001 G1 225.01 N 4 144209516 I56T A G missense Het probably benign 0.000 06/07/2019
9 556904 UTSW Clip1 0.000 PIT4812001 G1 225.01 N 5 123630675 R620S T A missense Het probably benign 0.083 phenotype 06/07/2019
10 556905 UTSW Cped1 0.069 PIT4812001 G1 225.01 N 6 22122294 F391S T C missense Het probably benign 0.022 06/07/2019
11 556910 UTSW Cracr2a 0.000 PIT4812001 G1 198.01 N 6 127625870 L230P T C missense Het probably damaging 1.000 06/07/2019
12 556907 UTSW Dctn1 1.000 PIT4812001 G1 199.01 N 6 83199762 V1266E T A missense Het possibly damaging 0.861 phenotype 06/07/2019
13 556942 UTSW Dlg1 1.000 PIT4812001 G1 225.01 N 16 31846885 F687I T A missense Het probably benign 0.013 phenotype 06/07/2019
14 556944 UTSW Dnah8 0.309 PIT4812001 G1 225.01 N 17 30708445 D1358E C A missense Het probably benign 0.035 phenotype 06/07/2019
15 556902 UTSW Dnajc11 0.935 PIT4812001 G1 216.01 N 4 151952889 R84G A G missense Het probably benign 0.040 phenotype 06/07/2019
16 556921 UTSW Dnajc14 0.000 PIT4812001 G1 141.01 N 10 128806683 T158N C A missense Het probably damaging 0.963 06/07/2019
17 556934 UTSW Dscc1 0.959 PIT4812001 G1 177.01 N 15 55082261 L346P A G missense Het probably damaging 1.000 phenotype 06/07/2019
18 556925 UTSW Efcab3 0.000 PIT4812001 G1 225.01 N 11 105099979 I71V A G missense Het probably null 0.001 06/07/2019
19 556920 UTSW Erbb3 1.000 PIT4812001 G1 160.01 N 10 128574379 Q670L T A missense Het possibly damaging 0.668 phenotype 06/07/2019
20 556940 UTSW Ercc4 0.971 PIT4812001 G1 225.01 N 16 13144447 E652K G A missense Het probably benign 0.289 phenotype 06/07/2019
21 556930 UTSW Ercc6l2 0.203 PIT4812001 G1 167.01 N 13 63858257 V591D T A missense Het possibly damaging 0.576 phenotype 06/07/2019
22 556889 UTSW Fam126b 0.822 PIT4812001 G1 225.01 N 1 58548703 D117A T G missense Het possibly damaging 0.778 06/07/2019
23 556906 UTSW Fam3c 0.244 PIT4812001 G1 225.01 N 6 22321370 G134E C T missense Het probably damaging 1.000 phenotype 06/07/2019
24 556898 UTSW Frmd5 0.000 PIT4812001 G1 225.01 N 2 121586446 V70A A G missense Het probably benign 0.345 06/07/2019
25 556924 UTSW Gjc1 1.000 PIT4812001 G1 225.01 N 11 102800981 Y65* A T nonsense Het probably null phenotype 06/07/2019
26 556931 UTSW Gm3033 PIT4812001 G1 225.01 N 14 3848891 L137F A C missense Het 06/07/2019
27 556914 UTSW Gria4 0.506 PIT4812001 G1 225.01 N 9 4427128 A771S C A missense Het probably damaging 1.000 phenotype 06/07/2019
28 556894 UTSW Hc 0.674 PIT4812001 G1 225.01 N 2 35029452 L674P A G missense Het probably benign 0.160 phenotype 06/07/2019
29 556890 UTSW Hjurp 0.902 PIT4812001 G1 217.47 N 1 88266277 CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C utr 3 prime Het probably benign 06/07/2019
30 556912 UTSW Inpp5f 0.267 PIT4812001 G1 225.01 N 7 128692308 Y696F A T missense Het probably benign 0.389 phenotype 06/07/2019
31 556915 UTSW Itga11 0.095 PIT4812001 G1 225.01 N 9 62732193 Q157K C A missense Het probably damaging 0.998 phenotype 06/07/2019
32 556943 UTSW Itgb5 0.000 PIT4812001 G1 225.01 N 16 33919987 C489F G T missense Het probably damaging 0.997 phenotype 06/07/2019
33 556935 UTSW Klhl38 0.087 PIT4812001 G1 204.01 N 15 58322542 G264S C T missense Het probably benign 0.000 06/07/2019
34 556937 UTSW Krt78 0.086 PIT4812001 G1 225.01 N 15 101948069 V436M C T missense Het probably damaging 0.999 phenotype 06/07/2019
35 556926 UTSW Mia2 0.951 PIT4812001 G1 225.01 N 12 59101579 D75V A T missense Het possibly damaging 0.915 phenotype 06/07/2019
36 556913 UTSW Mphosph6 0.896 PIT4812001 G1 225.01 N 8 117799149 Q20L T A missense Het probably damaging 0.997 06/07/2019
37 556900 UTSW Ogfr 0.579 PIT4812001 G1 95.01 N 2 180595511 P630S C T missense Het possibly damaging 0.930 phenotype 06/07/2019
38 556896 UTSW Olfr1206 0.056 PIT4812001 G1 225.01 N 2 88864970 V122M G A missense Het probably benign 0.266 phenotype 06/07/2019
39 556948 UTSW Olfr1431 0.065 PIT4812001 G1 225.01 N 19 12210253 I229S T G missense Het probably damaging 0.996 phenotype 06/07/2019
40 556939 UTSW Olfr15 0.127 PIT4812001 G1 225.01 N 16 3839530 K186* A T nonsense Het probably null phenotype 06/07/2019
41 556893 UTSW Pbx3 1.000 PIT4812001 G1 155.01 N 2 34224619 E101G T C missense Het probably damaging 0.960 phenotype 06/07/2019
42 556933 UTSW Pcca 1.000 PIT4812001 G1 225.01 N 14 122790382 N587K T A missense Het probably benign 0.001 phenotype 06/07/2019
43 556897 UTSW Pdia3 1.000 PIT4812001 G1 225.01 N 2 121433530 A287S G T missense Het probably damaging 0.999 phenotype 06/07/2019
44 556922 UTSW Pfas 1.000 PIT4812001 G1 214.01 N 11 68990036 D209V T A missense Het phenotype 06/07/2019
45 556892 UTSW Pter 0.151 PIT4812001 G1 225.01 N 2 12980368 I170F A T missense Het probably damaging 0.972 06/07/2019
46 556919 UTSW Ptprq 0.355 PIT4812001 G1 225.01 N 10 107666567 V830E A T missense Het probably damaging 0.999 phenotype 06/07/2019
47 556908 UTSW Rab11fip5 0.000 PIT4812001 G1 87.01 N 6 85341558 D783G T C missense Het probably benign 0.384 0.090 phenotype 06/07/2019
48 556903 UTSW Rbm19 1.000 PIT4812001 G1 225.01 N 5 120128250 V446A T C missense Het possibly damaging 0.914 phenotype 06/07/2019
49 556891 UTSW Selp 0.149 PIT4812001 G1 168.01 N 1 164132263 N363D A G missense Het probably benign 0.286 phenotype 06/07/2019
50 556946 UTSW Six2 1.000 PIT4812001 G1 167.01 N 17 85685301 S258I C A missense Het possibly damaging 0.915 phenotype 06/07/2019
51 556936 UTSW Smc1b 0.676 PIT4812001 G1 147.01 N 15 85069651 V1139A A G missense Het possibly damaging 0.907 phenotype 06/07/2019
52 556938 UTSW Sp1 1.000 PIT4812001 G1 193.01 N 15 102408408 T121A A G missense Het possibly damaging 0.528 phenotype 06/07/2019
53 556932 UTSW Sucla2 0.902 PIT4812001 G1 225.01 N 14 73579449 I210L A T missense Het possibly damaging 0.886 phenotype 06/07/2019
54 556918 UTSW Trank1 0.000 PIT4812001 G1 225.01 N 9 111347912 L339P T C missense Het probably damaging 1.000 06/07/2019
55 556927 UTSW Ttll5 0.472 PIT4812001 G1 225.01 N 12 85926861 D794E T A missense Het probably benign 0.115 phenotype 06/07/2019
56 556923 UTSW Usp32 1.000 PIT4812001 G1 203.01 N 11 85010074 V1107I C T missense Het probably damaging 0.998 06/07/2019
57 556928 UTSW Vmn1r195 0.055 PIT4812001 G1 225.01 N 13 22278863 Y168H T C missense Het probably benign 0.221 06/07/2019
58 556929 UTSW Vmn1r223 0.052 PIT4812001 G1 225.01 N 13 23249890 N218S A G missense Het probably damaging 0.988 06/07/2019
59 556909 UTSW Vmn2r25 0.084 PIT4812001 G1 225.01 N 6 123823488 S632C T A missense Het probably damaging 1.000 06/07/2019
60 556911 UTSW Vwa3a 0.000 PIT4812001 G1 167.01 N 7 120776133 K390I A T missense Het probably damaging 1.000 06/07/2019
61 556899 UTSW Zfp442 0.060 PIT4812001 G1 196.01 N 2 150409741 C80* A T nonsense Het probably null 06/07/2019
62 556916 UTSW Zic1 0.921 PIT4812001 G1 225.01 N 9 91364341 I226N A T missense Het probably damaging 0.999 phenotype 06/07/2019
[records 1 to 62 of 62]