Incidental Mutations

93 incidental mutations are currently displayed, and affect 92 genes.
19 are Possibly Damaging.
33 are Probably Damaging.
28 are Probably Benign.
13 are Probably Null.
7 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 93 of 93] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 66069 UTSW Aar2 0.319 R0238 G1 225 N 2 156550973 V94G T G missense Het probably benign 0.000 0.090 phenotype 08/19/2013
2 66111 UTSW Acp5 0.650 R0238 G1 225 N 9 22129922 S70T A T missense Het possibly damaging 0.900 0.227 phenotype 08/19/2013
3 66126 UTSW Adcy1 0.000 R0238 G1 121 N 11 7139162 N525K C G missense Het possibly damaging 0.795 0.179 phenotype 08/19/2013
4 59094 UTSW Adra1d 0.095 R0238 G1 216 Y 2 131546214 V474F C A missense Het probably benign 0.007 0.070 phenotype 07/11/2013
5 66077 UTSW AI464131 0.000 R0238 G1 203 N 4 41498912 N239K A T missense Het probably benign 0.113 0.083 08/19/2013
6 66073 UTSW Aknad1 0.074 R0238 G1 225 N 3 108781239 M628V A G missense Het probably benign 0.000 phenotype 08/19/2013
7 66098 UTSW Alg8 1.000 R0238 G1 147 N 7 97383684 A T critical splice acceptor site Het probably null 0.950 phenotype 08/19/2013
8 66140 UTSW Cacna1d 0.747 R0238 G1 225 N 14 30123496 V572A A G missense Het probably benign 0.295 0.378 phenotype 08/19/2013
9 66086 UTSW Ccdc158 0.223 R0238 G1 225 N 5 92662118 M177R A C missense Het probably benign 0.306 0.071 08/19/2013
10 66146 UTSW Ccdc191 0.232 R0238 G1 188 N 16 43947496 R678* A T nonsense Het probably null 0.976 08/19/2013
11 98967 UTSW Cdkn2d 0.242 R0238 G1 191 Y 9 21290992 C A start gained Het probably benign phenotype 01/10/2014
12 66087 UTSW Cdx2 1.000 R0238 G1 225 N 5 147303287 T193K G T missense Het probably damaging 1.000 0.950 phenotype 08/19/2013
13 66147 UTSW Cfap44 0.000 R0238 G1 225 N 16 44422318 M695K T A missense Het probably benign 0.000 0.090 phenotype 08/19/2013
14 66139 UTSW Cfap70 0.074 R0238 G1 225 N 14 20448605 S5A A C missense Het probably benign 0.006 0.090 08/19/2013
15 66106 UTSW Chd9 0.000 R0238 G1 225 N 8 90932828 S139P T C missense Het probably damaging 0.999 0.085 08/19/2013
16 66142 UTSW Chmp7 1.000 R0238 G1 158 N 14 69720997 V241A A G missense Het probably damaging 0.982 0.580 08/19/2013
17 66085 UTSW Cnga1 0.415 R0238 G1 225 N 5 72605031 I380T A G missense Het probably damaging 0.967 0.910 phenotype 08/19/2013
18 66137 UTSW Cts6 0.000 R0238 G1 222 N 13 61201819 E53D T A missense Het probably damaging 1.000 0.647 08/19/2013
19 66118 UTSW Dclk3 0.272 R0238 G1 170 N 9 111482628 N646I A T missense Het probably damaging 0.994 0.093 phenotype 08/19/2013
20 66100 UTSW Dnhd1 0.091 R0238 G1 200 N 7 105721531 S4673G A G missense Het probably benign 0.057 0.092 08/19/2013
21 66131 UTSW Dock4 0.191 R0238 G1 225 N 12 40737540 S818I G T missense Het probably damaging 0.978 0.487 phenotype 08/19/2013
22 66089 UTSW Dysf 0.000 R0238 G1 138 N 6 84064479 Q156* C T nonsense Het probably null 0.975 phenotype 08/19/2013
23 59085 UTSW Espnl 0.000 R0238 G1 179 Y 1 91322287 V52A T C missense Het probably damaging 0.969 0.555 07/11/2013
24 66065 UTSW Fam163b 0.063 R0238 G1 167 N 2 27112634 N117S T C missense Het probably damaging 0.999 0.432 08/19/2013
25 66109 UTSW Fam89a 0.064 R0238 G1 225 N 8 124741232 Y114H A G missense Het probably damaging 1.000 0.340 08/19/2013
26 66127 UTSW Flcn 1.000 R0238 G1 175 N 11 59801076 N249S T C missense Het probably benign 0.001 0.073 phenotype 08/19/2013
27 66105 UTSW Gm20422 R0238 G1 225 N 8 69766715 Y53C T C missense Het probably damaging 0.999 0.647 08/19/2013
28 66081 UTSW Gnai1 0.000 R0238 G1 126 N 5 18273550 S206P A G missense Het probably damaging 1.000 phenotype 08/19/2013
29 66122 UTSW Hal 0.097 R0238 G1 225 N 10 93503482 S478P T C missense Het possibly damaging 0.613 0.092 phenotype 08/19/2013
30 66084 UTSW Haus3 1.000 R0238 G1 138 N 5 34166256 P337S G A missense Het possibly damaging 0.537 0.406 phenotype 08/19/2013
31 66132 UTSW Hectd1 1.000 R0238 G1 225 N 12 51769318 M1324L T A missense Het possibly damaging 0.720 0.165 phenotype 08/19/2013
32 66136 UTSW Hist1h1t 0.000 R0238 G1 204 N 13 23696324 K153N G T missense Het possibly damaging 0.921 0.151 phenotype 08/19/2013
33 66151 UTSW Hspa9 0.966 R0238 G1 221 N 18 34946646 Y243* A T nonsense Het probably null 0.975 phenotype 08/19/2013
34 66113 UTSW Htr3a 0.000 R0238 G1 129 N 9 48906386 T96A T C missense Het probably benign 0.058 0.125 phenotype 08/19/2013
35 66149 UTSW Ift140 1.000 R0238 G1 190 N 17 25045523 C557* C A nonsense Het probably null 0.976 phenotype 08/19/2013
36 66108 UTSW Jph3 0.272 R0238 G1 216 N 8 121753720 Q379R A G missense Het possibly damaging 0.830 0.158 phenotype 08/19/2013
37 66071 UTSW Kcnb1 0.000 R0238 G1 160 N 2 167104969 V653A A G missense Het probably benign 0.041 0.090 phenotype 08/19/2013
38 66062 UTSW Kif14 0.892 R0238 G1 225 N 1 136527393 E1551G A G missense Het probably damaging 0.988 0.316 phenotype 08/19/2013
39 66130 UTSW Krt17 0.000 R0238 G1 214 N 11 100260878 R30* G A nonsense Het probably null 0.976 phenotype 08/19/2013
40 66063 UTSW Lamb3 0.181 R0238 G1 143 N 1 193321053 D100V A T missense Het probably damaging 1.000 0.335 phenotype 08/19/2013
41 66059 UTSW Map2 0.757 R0238 G1 225 N 1 66416106 D1385G A G missense Het probably damaging 1.000 0.246 phenotype 08/19/2013
42 66110 UTSW Map3k21 0.244 R0238 G1 225 N 8 125944970 D999G A G missense Het possibly damaging 0.674 0.179 08/19/2013
43 66145 UTSW Marf1 0.212 R0238 G1 225 N 16 14151283 I109V T C missense Het probably benign 0.001 0.090 phenotype 08/19/2013
44 66112 UTSW Mcam 0.545 R0238 G1 225 N 9 44140205 T G unclassified 3136 bp Het probably null 0.967 phenotype 08/19/2013
45 66079 UTSW Med18 0.950 R0238 G1 225 N 4 132460026 H99R T C missense Het probably damaging 0.961 0.357 phenotype 08/19/2013
46 66123 UTSW Mettl25 0.188 R0238 G1 225 N 10 105826525 V195I C T missense Het probably damaging 0.995 0.228 08/19/2013
47 59170 UTSW Micu2 0.000 R0238 G1 139 Y 14 57917378 G A splice site Het probably benign phenotype 07/11/2013
48 66128 UTSW Myh8 0.769 R0238 G1 225 N 11 67301692 T1466A A G missense Het probably benign 0.001 0.082 phenotype 08/19/2013
49 66115 UTSW Myo1e 0.000 R0238 G1 148 N 9 70342126 I503F A T missense Het possibly damaging 0.864 0.254 phenotype 08/19/2013
50 66066 UTSW Myo3b 0.000 R0238 G1 225 N 2 70105425 C61S T A missense Het probably benign 0.005 0.082 phenotype 08/19/2013
51 59114 UTSW Ndufa4 0.153 R0238 G1 225 Y 6 11906024 V10I C T missense Het probably benign 0.140 0.136 phenotype 07/11/2013
52 66129 UTSW Nf1 1.000 R0238 G1 225 N 11 79418574 K438M A T missense Het possibly damaging 0.886 0.122 phenotype 08/19/2013
53 66095 UTSW Nlrp9c 0.000 R0238 G1 225 N 7 26378012 S727P A G missense Het possibly damaging 0.904 0.179 08/19/2013
54 66120 UTSW Nmbr 0.077 R0238 G1 225 N 10 14770395 Q338* C T nonsense Het probably null 0.972 phenotype 08/19/2013
55 66116 UTSW Nt5e 0.000 R0238 G1 177 N 9 88367332 S440G A G missense Het possibly damaging 0.810 0.337 phenotype 08/19/2013
56 66148 UTSW Nubp2 1.000 R0238 G1 191 N 17 24884471 E144G T C missense Het probably damaging 1.000 0.945 phenotype 08/19/2013
57 66067 UTSW Olfr1126 0.088 R0238 G1 225 N 2 87458037 F291L T C missense Het probably benign 0.001 0.090 phenotype 08/19/2013
58 66099 UTSW Olfr593 0.065 R0238 G1 225 N 7 103212726 V289M G A missense Het possibly damaging 0.928 0.179 phenotype 08/19/2013
59 66101 UTSW Olfr694 0.092 R0238 G1 225 N 7 106689255 Y159H A G missense Het probably benign 0.001 0.080 phenotype 08/19/2013
60 66124 UTSW Otogl 0.000 R0238 G1 225 N 10 107806696 N1291I T A missense Het probably damaging 0.983 0.251 phenotype 08/19/2013
61 66125 UTSW Pa2g4 0.765 R0238 G1 159 N 10 128563642 K51R T C missense Het probably benign 0.000 0.062 phenotype 08/19/2013
62 59149 UTSW Pah 0.000 R0238 G1 225 Y 10 87567281 P173S C T missense Het possibly damaging 0.737 0.917 phenotype 07/11/2013
63 66152 UTSW Pcdhb12 0.069 R0238 G1 225 N 18 37436727 I309V A G missense Het probably benign 0.005 0.082 08/19/2013
64 66072 UTSW Pck1 1.000 R0238 G1 216 N 2 173157068 I373S T G missense Het possibly damaging 0.906 0.361 phenotype 08/19/2013
65 66155 UTSW Pga5 0.068 R0238 G1 225 N 19 10669453 Y305H A G missense Het probably damaging 0.999 0.647 08/19/2013
66 66091 UTSW Plxnd1 1.000 R0238 G1 225 N 6 115968793 D906E G T missense Het probably benign 0.001 0.096 phenotype 08/19/2013
67 66060 UTSW Ppfia4 0.109 R0238 G1 225 N 1 134329189 E98G T C missense Het possibly damaging 0.892 0.155 08/19/2013
68 66114 UTSW Rab39 0.000 R0238 G1 190 N 9 53706030 T29I G A missense Het probably damaging 0.976 0.361 08/19/2013
69 66121 UTSW Raet1e 0.697 R0238 G1 225 N 10 22180862 H112Q C A missense Het possibly damaging 0.649 0.179 08/19/2013
70 66075 UTSW Rars2 1.000 R0238 G1 225 N 4 34645838 Y252H T C missense Het probably damaging 1.000 0.580 phenotype 08/19/2013
71 66076 UTSW Rars2 1.000 R0238 G1 211 N 4 34656030 Q421P A C missense Het probably benign 0.001 0.089 phenotype 08/19/2013
72 66117 UTSW Rasa2 0.102 R0238 G1 180 N 9 96568407 D479E A T missense Het probably damaging 1.000 0.221 phenotype 08/19/2013
73 66107 UTSW Rbl2 1.000 R0238 G1 204 N 8 91106507 T689S A T missense Het probably damaging 0.992 0.078 phenotype 08/19/2013
74 66070 UTSW Rims4 0.182 R0238 G1 201 N 2 163864025 V230M C T missense Het probably benign 0.030 0.070 phenotype 08/19/2013
75 59179 UTSW Six3 1.000 R0238 G1 126 Y 17 85621390 G51R G A missense Het probably damaging 0.996 0.073 phenotype 07/11/2013
76 66143 UTSW Skp2 0.000 R0238 G1 127 N 15 9127884 A C critical splice donor site 2 bp Het probably null 0.949 phenotype 08/19/2013
77 66141 UTSW Slc35f4 0.162 R0238 G1 184 N 14 49304256 I347N A T missense Het possibly damaging 0.780 0.763 08/19/2013
78 66082 UTSW Slc4a2 0.729 R0238 G1 225 N 5 24436274 A T splice site 3 bp Het probably null 0.976 phenotype 08/19/2013
79 66068 UTSW Slc52a3 1.000 R0238 G1 192 N 2 152008156 *461Q T C makesense Het probably null 0.782 phenotype 08/19/2013
80 66090 UTSW Slc6a1 0.177 R0238 G1 225 N 6 114302800 V142I G A missense Het probably benign 0.131 0.142 phenotype 08/19/2013
81 66119 UTSW Susd5 0.072 R0238 G1 160 N 9 114096909 *620W A G makesense Het probably null 0.857 08/19/2013
82 66153 UTSW Timm21 0.000 R0238 G1 225 N 18 84947666 N239S T C missense Het probably damaging 0.999 0.523 phenotype 08/19/2013
83 66133 UTSW Tmem63c 0.093 R0238 G1 140 N 12 87075639 W404R T C missense Het probably damaging 1.000 0.912 08/19/2013
84 66144 UTSW Tnrc6b 0.210 R0238 G1 138 N 15 80887864 D1118G A G missense Het probably damaging 0.998 0.224 phenotype 08/19/2013
85 66064 UTSW Traf2 1.000 R0238 G1 139 N 2 25537126 A71G G C missense Het possibly damaging 0.897 0.156 phenotype 08/19/2013
86 66083 UTSW Trim54 0.000 R0238 G1 216 N 5 31134119 M195V A G missense Het probably benign 0.182 0.077 phenotype 08/19/2013
87 66134 UTSW Trip11 1.000 R0238 G1 221 N 12 101884728 E741K C T missense Het probably damaging 1.000 0.099 phenotype 08/19/2013
88 501782 UTSW Trp73 0.587 R0238 G1 129 N 4 154062524 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG unclassified Het probably benign phenotype 12/01/2017
89 66103 UTSW Trpm5 0.088 R0238 G1 218 N 7 143082958 T414N G T missense Het probably damaging 0.998 0.647 phenotype 08/19/2013
90 66154 UTSW Vps51 1.000 R0238 G1 225 N 19 6071437 S185* G T nonsense Het probably null 0.976 phenotype 08/19/2013
91 66094 UTSW Zfp329 0.000 R0238 G1 141 N 7 12810829 T256K G T missense Het probably damaging 1.000 0.145 08/19/2013
92 66138 UTSW Zfp729b 0.117 R0238 G1 225 N 13 67591903 Y748H A G missense Het probably damaging 0.978 0.647 08/19/2013
93 66088 UTSW Zfp777 0.322 R0238 G1 225 N 6 48024969 E773G T C missense Het probably damaging 0.989 0.204 08/19/2013
[records 1 to 93 of 93]