Incidental Mutations

99 incidental mutations are currently displayed, and affect 98 genes.
13 are Possibly Damaging.
34 are Probably Damaging.
40 are Probably Benign.
8 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 99 of 99] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 40220 UTSW 4933427G23Rik R0415 G1 215 N 5 23831050 A T unclassified Het noncoding transcript 05/23/2013
2 40275 UTSW Acox2 0.144 R0415 G1 225 Y 14 8243835 A G splice site Het probably benign phenotype 05/23/2013
3 40254 UTSW Adgb 0.000 R0415 G1 199 Y 10 10431067 T C splice site 4 bp Het probably null 0.976 05/23/2013
4 40221 UTSW Adgra3 0.000 R0415 G1 209 Y 5 49961757 C A splice site Het probably benign 0.090 phenotype 05/23/2013
5 40284 UTSW Adgre4 0.000 R0415 G1 225 N 17 55852288 V658I G A missense Het probably benign 0.031 05/23/2013
6 40287 UTSW Ahnak 0.277 R0415 G1 159 Y 19 9012871 A G intron Het probably benign 0.133 phenotype 05/23/2013
7 40202 UTSW Anapc2 1.000 R0415 G1 225 Y 2 25278325 T159A A G missense Het probably damaging 0.998 0.189 phenotype 05/23/2013
8 40255 UTSW Arfgef3 0.165 R0415 G1 225 Y 10 18613127 A G splice site Het probably benign phenotype 05/23/2013
9 40236 UTSW Atf7ip 0.860 R0415 G1 225 Y 6 136560012 S81L C T missense Het possibly damaging 0.922 0.179 phenotype 05/23/2013
10 40282 UTSW Cacna1i 0.000 R0415 G1 225 Y 15 80368830 A G splice site Het probably benign phenotype 05/23/2013
11 40234 UTSW Camk1 0.000 R0415 G1 156 Y 6 113341891 Y20* A T nonsense Het probably null 0.976 phenotype 05/23/2013
12 40264 UTSW Ccdc40 0.500 R0415 G1 216 Y 11 119232118 Y249H T C missense Het possibly damaging 0.915 0.179 phenotype 05/23/2013
13 40251 UTSW Cd109 0.000 R0415 G1 225 Y 9 78712615 S1380T T A missense Het probably benign 0.129 0.059 phenotype 05/23/2013
14 40216 UTSW Cfap57 0.000 R0415 G1 204 Y 4 118569431 L1107Q A T missense Het possibly damaging 0.894 0.227 phenotype 05/23/2013
15 40253 UTSW Col6a4 0.000 R0415 G1 218 Y 9 106075080 V540I C T missense Het probably damaging 0.994 0.647 05/23/2013
16 40208 UTSW Cst9 0.000 R0415 G1 152 Y 2 148838442 T A splice site Het probably benign phenotype 05/23/2013
17 177898 UTSW Cul5 1.000 R0415 G1 72 Y 9 53667070 V73I C T missense Het probably benign 0.001 0.090 phenotype 04/30/2014
18 40260 UTSW Cxcl16 0.068 R0415 G1 225 N 11 70458748 K84* T A nonsense Het probably null phenotype 05/23/2013
19 40288 UTSW Cyp2c29 0.107 R0415 G1 113 Y 19 39329095 T C splice site Het probably benign 05/23/2013
20 40231 UTSW D6Ertd527e 0.123 R0415 G1 168 Y 6 87111524 T223S C G missense Het unknown 0.087 05/23/2013
21 40269 UTSW Dip2c 0.568 R0415 G1 126 Y 13 9568289 C T splice site Het probably benign phenotype 05/23/2013
22 40278 UTSW Dis3 1.000 R0415 G1 225 Y 14 99087456 I513N A T missense Het probably damaging 1.000 0.840 05/23/2013
23 40218 UTSW Dnajc16 0.541 R0415 G1 225 Y 4 141789048 L3* A T nonsense Het probably null 0.976 05/23/2013
24 40252 UTSW Dopey1 0.255 R0415 G1 219 Y 9 86506502 L480M T A missense Het probably damaging 1.000 0.535 05/23/2013
25 40257 UTSW Eml6 0.287 R0415 G1 208 Y 11 29749392 V1787A A G missense Het possibly damaging 0.836 0.084 05/23/2013
26 40237 UTSW Etnk1 0.000 R0415 G1 225 Y 6 143180774 N115S A G missense Het probably damaging 1.000 0.552 phenotype 05/23/2013
27 40222 UTSW Fryl 0.770 R0415 G1 225 Y 5 73098414 Y758C T C missense Het probably damaging 0.985 0.600 phenotype 05/23/2013
28 40223 UTSW Gbp4 0.000 R0415 G1 176 Y 5 105121106 R394C G A missense Het possibly damaging 0.853 0.179 05/23/2013
29 40262 UTSW Ggnbp2 0.923 R0415 G1 137 Y 11 84833225 A C splice site Het probably benign phenotype 05/23/2013
30 40256 UTSW Gm7137 0.118 R0415 G1 165 N 10 77788173 A G intron Het probably benign 05/23/2013
31 40213 UTSW Gstm2 0.114 R0415 G1 154 Y 3 107984006 Q132L T A missense Het probably benign 0.369 0.090 phenotype 05/23/2013
32 40289 UTSW Habp2 0.104 R0415 G1 191 Y 19 56317717 T C unclassified Het probably benign phenotype 05/23/2013
33 177900 UTSW Hectd2 0.000 R0415 G1 73 Y 19 36584884 T C unclassified Het probably benign 04/30/2014
34 177896 UTSW Htr6 0.092 R0415 G1 64 Y 4 139062081 I291T A G missense Het possibly damaging 0.529 0.446 phenotype 04/30/2014
35 40268 UTSW Ighg2c 0.111 R0415 G1 225 Y 12 113287910 D199G T C missense Het unknown 0.087 05/23/2013
36 40200 UTSW Itih2 0.117 R0415 G1 210 Y 2 10105615 A G unclassified Het probably benign 0.090 phenotype 05/23/2013
37 40219 UTSW Kcnab2 0.090 R0415 G1 211 Y 4 152395136 F248S A G missense Het probably benign 0.387 0.542 phenotype 05/23/2013
38 40212 UTSW Kcnc4 0.108 R0415 G1 120 Y 3 107445433 K610E T C missense Het probably damaging 0.995 0.248 phenotype 05/23/2013
39 40276 UTSW Kcnk16 0.089 R0415 G1 210 Y 14 20262975 T A critical splice acceptor site Het probably null 0.923 phenotype 05/23/2013
40 40245 UTSW Kndc1 0.000 R0415 G1 225 Y 7 139930124 T1293I C T missense Het probably damaging 0.999 0.647 phenotype 05/23/2013
41 40277 UTSW Lcp1 1.000 R0415 G1 137 Y 14 75227006 I556F A T missense Het possibly damaging 0.881 0.655 phenotype 05/23/2013
42 40224 UTSW Lrrc8d 0.000 R0415 G1 225 Y 5 105811865 L47P T C missense Het probably damaging 1.000 0.491 05/23/2013
43 40271 UTSW Lyst 0.269 R0415 G1 220 Y 13 13711610 T C splice site Het probably benign phenotype 05/23/2013
44 40207 UTSW Macrod2 0.000 R0415 G1 203 Y 2 142210145 G A critical splice donor site 1 bp Het probably null 0.949 05/23/2013
45 40243 UTSW Micalcl 0.000 R0415 G1 225 Y 7 112381028 R70C C T missense Het probably damaging 1.000 0.647 05/23/2013
46 66508 UTSW Mllt3 1.000 R0415 G1 101 Y 4 87841339 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT utr 3 prime Het probably benign phenotype 08/19/2013
47 40274 UTSW Msh3 0.400 R0415 G1 225 Y 13 92346786 V283A A G missense Het possibly damaging 0.892 0.179 phenotype 05/23/2013
48 40228 UTSW Nup205 0.959 R0415 G1 162 Y 6 35214634 T C splice site Het probably benign phenotype 05/23/2013
49 40250 UTSW Nxpe2 0.075 R0415 G1 184 Y 9 48326614 T114A T C missense Het probably damaging 0.994 0.248 05/23/2013
50 40203 UTSW Olfr1023 0.070 R0415 G1 225 Y 2 85887438 I213F A T missense Het possibly damaging 0.940 0.248 phenotype 05/23/2013
51 40204 UTSW Olfr1034 0.456 R0415 G1 225 Y 2 86047055 H191L A T missense Het probably benign 0.001 0.260 phenotype 05/23/2013
52 40248 UTSW Olfr229 0.117 R0415 G1 180 Y 9 39909983 Y60C A G missense Het probably damaging 1.000 0.647 phenotype 05/23/2013
53 40242 UTSW Olfr78 0.060 R0415 G1 215 Y 7 102742087 M305I C T missense Het probably benign 0.021 0.106 phenotype 05/23/2013
54 40247 UTSW Olfr893 0.074 R0415 G1 168 Y 9 38209973 M305L A T missense Het probably benign 0.000 0.090 phenotype 05/23/2013
55 40246 UTSW Pard3 1.000 R0415 G1 225 Y 8 127610566 G1221D G A missense Het probably damaging 1.000 0.647 phenotype 05/23/2013
56 40215 UTSW Pax5 1.000 R0415 G1 225 Y 4 44691886 A120V G A missense Het probably damaging 0.999 0.292 phenotype 05/23/2013
57 40239 UTSW Pcsk6 0.313 R0415 G1 88 Y 7 66033874 R746C C T missense Het probably damaging 0.999 0.248 phenotype 05/23/2013
58 177899 UTSW Pif1 0.000 R0415 G1 23 Y 9 65588051 C81Y G A missense Het probably benign 0.001 0.058 phenotype 04/30/2014
59 40206 UTSW Plcb1 0.228 R0415 G1 225 Y 2 135337499 Y609C A G missense Het probably damaging 1.000 0.957 phenotype 05/23/2013
60 40198 UTSW Plcd4 0.000 R0415 G1 225 Y 1 74552097 S217Y C A missense Het probably damaging 0.992 0.647 phenotype 05/23/2013
61 40232 UTSW Plxna1 0.830 R0415 G1 225 Y 6 89357336 H104Y G A missense Het probably benign 0.121 0.159 phenotype 05/23/2013
62 40279 UTSW Polr2k 0.631 R0415 G1 155 Y 15 36175456 Y45C A G missense Het probably damaging 1.000 0.854 phenotype 05/23/2013
63 40266 UTSW Pqlc3 0.000 R0415 G1 124 Y 12 16997710 C A splice site Het probably benign 05/23/2013
64 40210 UTSW Prex1 0.206 R0415 G1 225 Y 2 166586699 A G unclassified Het probably benign 0.090 phenotype 05/23/2013
65 40197 UTSW Pth2r 0.000 R0415 G1 177 Y 1 65388439 M424V A G missense Het probably benign 0.000 0.089 phenotype 05/23/2013
66 40286 UTSW Pygm 0.000 R0415 G1 225 Y 19 6391366 R464G A G missense Het probably benign 0.065 0.200 phenotype 05/23/2013
67 40263 UTSW Rad51c 1.000 R0415 G1 185 Y 11 87397655 L234P A G missense Het probably damaging 0.985 0.179 phenotype 05/23/2013
68 40259 UTSW Rnf145 0.127 R0415 G1 183 Y 11 44525138 Y60C A G missense Het probably damaging 0.994 0.264 05/23/2013
69 40261 UTSW Rnf167 0.137 R0415 G1 217 Y 11 70649699 I135T T C missense Het probably damaging 0.993 0.900 phenotype 05/23/2013
70 40265 UTSW Rnf213 0.000 R0415 G1 201 Y 11 119414469 I509F A T missense Het probably damaging 0.996 0.647 phenotype 05/23/2013
71 40270 UTSW Ryr2 1.000 R0415 G1 135 Y 13 11869156 S213G T C missense Het probably damaging 0.968 0.155 phenotype 05/23/2013
72 40211 UTSW Selenbp1 0.000 R0415 G1 188 Y 3 94936913 V27A T C missense Het possibly damaging 0.608 0.110 phenotype 05/23/2013
73 40214 UTSW Selenof 0.000 R0415 G1 225 Y 3 144577692 L14R T G missense Het probably damaging 0.996 0.089 phenotype 05/23/2013
74 40226 UTSW Sfswap 0.000 R0415 G1 149 Y 5 129504126 D121V A T missense Het probably damaging 0.999 0.652 phenotype 05/23/2013
75 40217 UTSW Slc25a34 0.071 R0415 G1 223 Y 4 141620469 M300I C A missense Het possibly damaging 0.482 0.157 phenotype 05/23/2013
76 40201 UTSW Slc34a3 0.104 R0415 G1 225 Y 2 25229110 T583P T G missense Het probably benign 0.000 0.107 phenotype 05/23/2013
77 40244 UTSW Smg1 1.000 R0415 G1 225 Y 7 118182468 A1199S C A missense Het probably benign 0.338 0.074 phenotype 05/23/2013
78 40205 UTSW Spint1 1.000 R0415 G1 225 Y 2 119245615 T231A A G missense Het probably damaging 1.000 0.437 phenotype 05/23/2013
79 40258 UTSW Sptbn1 1.000 R0415 G1 217 Y 11 30149576 N229K A C missense Het probably damaging 1.000 0.647 phenotype 05/23/2013
80 40238 UTSW Sult2b1 0.135 R0415 G1 177 Y 7 45730092 A G unclassified Het probably benign 0.090 phenotype 05/23/2013
81 40235 UTSW Tas2r123 0.053 R0415 G1 225 Y 6 132847838 M233L A T missense Het probably damaging 0.974 0.322 05/23/2013
82 40249 UTSW Tbcel 0.174 R0415 G1 222 Y 9 42444500 C139F C A missense Het probably benign 0.425 0.070 05/23/2013
83 40283 UTSW Thbs2 0.158 R0415 G1 225 Y 17 14679973 S573A A C missense Het probably benign 0.000 0.116 phenotype 05/23/2013
84 40225 UTSW Tmem132c 0.153 R0415 G1 225 Y 5 127563705 E980G A G missense Het probably damaging 1.000 0.252 05/23/2013
85 40285 UTSW Tmem247 0.061 R0415 G1 225 Y 17 86922322 C197F G T missense Het probably damaging 0.979 0.304 05/23/2013
86 40267 UTSW Tmem251 0.398 R0415 G1 81 Y 12 102744876 Y119* T A nonsense Het probably null 0.976 05/23/2013
87 40233 UTSW Tmem43 0.000 R0415 G1 144 Y 6 91482318 P257Q C A missense Het probably benign 0.126 0.119 phenotype 05/23/2013
88 261764 UTSW Tmprss13 0.000 R0415 G1 225 N 9 45337132 A G intron 43 bp Het probably null phenotype 02/03/2015
89 40199 UTSW Trove2 0.341 R0415 G1 168 Y 1 143760075 N444K G T missense Het probably benign 0.001 0.090 phenotype 05/23/2013
90 40280 UTSW Ubr5 1.000 R0415 G1 225 Y 15 37972980 T2626A T C missense Het probably damaging 0.980 0.647 phenotype 05/23/2013
91 40272 UTSW Vmn1r196 0.058 R0415 G1 105 Y 13 22293836 V215D T A missense Het probably damaging 0.999 0.647 05/23/2013
92 40230 UTSW Vmn1r22 0.126 R0415 G1 225 Y 6 57900332 T220K G T missense Het probably benign 0.181 0.090 05/23/2013
93 66510 UTSW Vmn2r116 0.067 R0415 G1 163 Y 17 23387279 M388I G A missense Het possibly damaging 0.554 0.179 phenotype 08/19/2013
94 40240 UTSW Vmn2r74 0.105 R0415 G1 170 Y 7 85961410 C25G A C missense Het probably damaging 0.998 0.647 05/23/2013
95 40241 UTSW Xndc1 1.000 R0415 G1 102 Y 7 102080616 T C splice site Het probably benign phenotype 05/23/2013
96 40229 UTSW Zfp282 0.100 R0415 G1 182 Y 6 47897881 D340G A G missense Het probably damaging 0.992 0.148 05/23/2013
97 177897 UTSW Zfp282 0.100 R0415 G1 60 Y 6 47905053 I558N T A missense Het possibly damaging 0.876 0.130 04/30/2014
98 40227 UTSW Zfp316 0.178 R0415 G1 86 Y 5 143264491 T56S T A missense Het unknown 0.087 05/23/2013
99 40209 UTSW Zfp345 0.119 R0415 G1 206 Y 2 150474559 A G splice site Het probably benign 05/23/2013
[records 1 to 99 of 99]