Incidental Mutations

74 incidental mutations are currently displayed, and affect 74 genes.
11 are Possibly Damaging.
22 are Probably Damaging.
34 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 74 of 74] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 37020 UTSW 4930415O20Rik 0.138 R0420 G1 225 Y 15 98571094 S17G A G missense Het probably benign 0.156 0.090 05/09/2013
2 36971 UTSW Abcb4 0.000 R0420 G1 204 Y 5 8941050 V870A T C missense Het probably benign 0.034 0.064 phenotype 05/09/2013
3 37011 UTSW Adam6b 0.051 R0420 G1 225 Y 12 113489994 M144L A T missense Het probably benign 0.021 0.090 05/09/2013
4 37025 UTSW Adrb2 0.000 R0420 G1 225 Y 18 62179539 I72L T A missense Het possibly damaging 0.760 0.179 phenotype 05/09/2013
5 36981 UTSW Ankrd53 0.000 R0420 G1 225 Y 6 83763692 H99L A T missense Het probably damaging 0.999 0.191 05/09/2013
6 36961 UTSW Ap4e1 0.190 R0420 G1 225 Y 2 127049360 T17M C T missense Het probably damaging 1.000 0.647 phenotype 05/09/2013
7 36968 UTSW Arnt 1.000 R0420 G1 225 Y 3 95470394 T A splice site Het probably benign phenotype 05/09/2013
8 36986 UTSW Atp1a3 1.000 R0420 G1 193 Y 7 24980627 G884E C T missense Het probably benign 0.000 0.090 phenotype 05/09/2013
9 36980 UTSW Atp6v1b1 0.000 R0420 G1 187 Y 6 83752844 T C unclassified Het probably benign phenotype 05/09/2013
10 37017 UTSW Atp8a2 0.287 R0420 G1 203 Y 14 59773744 T971K G T missense Het probably damaging 0.999 0.647 phenotype 05/09/2013
11 36998 UTSW BC048562 0.000 R0420 G1 225 Y 9 108445966 T167S A T missense Het probably benign 0.016 0.069 05/09/2013
12 37014 UTSW Brd9 1.000 R0420 G1 225 Y 13 73955473 M491V A G missense Het probably benign 0.000 0.073 05/09/2013
13 37007 UTSW Btnl10 0.062 R0420 G1 225 Y 11 58923451 D319V A T missense Het probably damaging 1.000 0.687 05/09/2013
14 37016 UTSW Cadps 1.000 R0420 G1 225 Y 14 12491800 R783S T A missense Het probably damaging 0.998 0.647 phenotype 05/09/2013
15 36973 UTSW Ccdc149 0.082 R0420 G1 225 Y 5 52400239 A G splice site Het probably benign 05/09/2013
16 36965 UTSW Ccm2l 0.000 R0420 G1 155 Y 2 153070862 D107V A T missense Het probably null 0.078 0.695 phenotype 05/09/2013
17 37026 UTSW Cep192 0.000 R0420 G1 196 Y 18 67813893 E213G A G missense Het possibly damaging 0.906 0.179 05/09/2013
18 37028 UTSW Cyp2c37 0.074 R0420 G1 225 Y 19 39995794 N242T A C missense Het probably benign 0.005 0.090 05/09/2013
19 37009 UTSW Dnah17 0.000 R0420 G1 149 Y 11 118039939 V3750A A G missense Het probably damaging 0.998 0.246 phenotype 05/09/2013
20 37005 UTSW Ehbp1 0.713 R0420 G1 99 Y 11 22151836 I231L T A missense Het probably benign 0.000 0.059 phenotype 05/09/2013
21 36966 UTSW Emilin3 0.000 R0420 G1 192 Y 2 160910879 A G unclassified Het probably benign 0.090 05/09/2013
22 37000 UTSW Eya4 1.000 R0420 G1 225 Y 10 23155963 N254S T C missense Het possibly damaging 0.851 0.070 phenotype 05/09/2013
23 36972 UTSW Fam184b 0.000 R0420 G1 196 Y 5 45584512 S126P A G missense Het probably damaging 0.999 0.104 phenotype 05/09/2013
24 36983 UTSW Fancd2 1.000 R0420 G1 170 Y 6 113536979 L108P T C missense Het probably damaging 0.978 0.647 phenotype 05/09/2013
25 37021 UTSW Fgf12 0.000 R0420 G1 203 Y 16 28162529 M145K A T missense Het possibly damaging 0.767 0.260 phenotype 05/09/2013
26 157150 UTSW Gabbr1 0.653 R0420 G1 73 Y 17 37046762 N23S A G missense Het possibly damaging 0.675 0.060 phenotype 02/17/2014
27 37002 UTSW Ggt1 0.099 R0420 G1 225 Y 10 75576213 T A splice site Het probably benign phenotype 05/09/2013
28 36991 UTSW Gm1966 0.117 R0420 G1 208 Y 7 106603883 L51F T A missense Het probably damaging 1.000 0.647 05/09/2013
29 36987 UTSW Gm6434 0.945 R0420 G1 225 Y 7 25882361 T A exon Het noncoding transcript 0.084 05/09/2013
30 36984 UTSW Gm6614 0.067 R0420 G1 111 Y 6 141985477 T G splice site Het probably benign 05/09/2013
31 36995 UTSW Grik4 0.074 R0420 G1 225 Y 9 42622096 L376* A T nonsense Het probably null 0.975 phenotype 05/09/2013
32 36963 UTSW Gzf1 0.677 R0420 G1 225 Y 2 148683833 T75A A G missense Het probably benign 0.298 0.150 05/09/2013
33 37015 UTSW Hcn1 0.000 R0420 G1 225 Y 13 117975375 I625T T C missense Het unknown 0.082 phenotype 05/09/2013
34 36960 UTSW Hhat 1.000 R0420 G1 165 Y 1 192552934 C T splice site 5 bp Het probably null 0.976 phenotype 05/09/2013
35 157151 UTSW Ifit1bl1 0.000 R0420 G1 30 Y 19 34594514 E181G T C missense Het probably damaging 0.998 0.611 02/17/2014
36 37019 UTSW Kif21a 1.000 R0420 G1 225 Y 15 90968054 T C unclassified Het probably benign phenotype 05/09/2013
37 37010 UTSW Lrrc45 0.173 R0420 G1 225 Y 11 120715219 S118R A C missense Het probably damaging 0.998 0.081 05/09/2013
38 37001 UTSW Mcm9 0.000 R0420 G1 220 Y 10 53548527 I656V T C missense Het probably benign 0.099 0.074 phenotype 05/09/2013
39 37027 UTSW Ms4a5 0.068 R0420 G1 225 Y 19 11283654 L47S A G missense Het probably damaging 0.974 0.647 phenotype 05/09/2013
40 36967 UTSW Mynn 0.283 R0420 G1 225 Y 3 30607459 N230I A T missense Het probably benign 0.418 0.147 phenotype 05/09/2013
41 36958 UTSW Nck2 0.000 R0420 G1 225 Y 1 43554118 S162P T C missense Het probably damaging 1.000 0.949 phenotype 05/09/2013
42 36993 UTSW Nfat5 0.922 R0420 G1 225 Y 8 107367461 F259S T C missense Het probably damaging 0.999 0.332 phenotype 05/09/2013
43 36985 UTSW Obox1 0.161 R0420 G1 225 Y 7 15556253 S174A T G missense Het possibly damaging 0.897 0.179 05/09/2013
44 36974 UTSW Ociad1 0.069 R0420 G1 225 Y 5 73313429 T A splice site Het probably null 0.976 05/09/2013
45 37012 UTSW Pgbd1 0.000 R0420 G1 225 Y 13 21423166 V286E A T missense Het possibly damaging 0.500 0.179 phenotype 05/09/2013
46 36994 UTSW Phlpp2 0.222 R0420 G1 225 Y 8 109939935 V1032A T C missense Het probably damaging 0.993 0.706 phenotype 05/09/2013
47 37008 UTSW Ppm1e 0.333 R0420 G1 222 Y 11 87240614 A318T C T missense Het probably damaging 0.981 0.124 phenotype 05/09/2013
48 157149 UTSW Prex1 0.303 R0420 G1 41 Y 2 166589571 D757V T A missense Het probably benign 0.125 0.141 phenotype 02/17/2014
49 37013 UTSW Ptpdc1 0.000 R0420 G1 178 Y 13 48589119 C A critical splice donor site 1 bp Het probably null 0.949 phenotype 05/09/2013
50 36959 UTSW Rbbp5 0.953 R0420 G1 225 Y 1 132493844 I94R T G missense Het possibly damaging 0.876 0.268 phenotype 05/09/2013
51 36969 UTSW Rnpc3 1.000 R0420 G1 225 Y 3 113621869 V173A A G missense Het probably benign 0.001 0.059 phenotype 05/09/2013
52 36975 UTSW Sgsm1 0.000 R0420 G1 225 Y 5 113263759 N700K A T missense Het probably benign 0.161 0.088 05/09/2013
53 36997 UTSW Sox14 0.338 R0420 G1 190 Y 9 99875122 H188L T A missense Het probably damaging 0.999 0.150 phenotype 05/09/2013
54 36988 UTSW Supt5 1.000 R0420 G1 225 Y 7 28317329 T A splice site Het probably benign 05/09/2013
55 37024 UTSW Synpo 0.188 R0420 G1 225 Y 18 60602418 S819P A G missense Het probably damaging 0.972 0.647 phenotype 05/09/2013
56 37006 UTSW Tenm2 0.612 R0420 G1 150 Y 11 36207124 A G splice site Het probably benign 0.090 phenotype 05/09/2013
57 36989 UTSW Tenm4 1.000 R0420 G1 225 Y 7 96873766 V1468A T C missense Het possibly damaging 0.849 0.100 phenotype 05/09/2013
58 37022 UTSW Tiam2 0.000 R0420 G1 225 Y 17 3502918 N83S A G missense Het probably benign 0.010 0.075 phenotype 05/09/2013
59 37003 UTSW Tle6 0.160 R0420 G1 189 Y 10 81595311 T C unclassified Het probably benign phenotype 05/09/2013
60 36992 UTSW Tm2d2 1.000 R0420 G1 101 Y 8 25018114 N91K T G missense Het probably damaging 1.000 0.589 phenotype 05/09/2013
61 36976 UTSW Tmem132d 0.156 R0420 G1 225 Y 5 127864646 Q463H T G missense Het probably benign 0.259 0.090 05/09/2013
62 36982 UTSW Tmf1 0.181 R0420 G1 225 Y 6 97176141 S324P A G missense Het probably damaging 1.000 0.077 phenotype 05/09/2013
63 36970 UTSW Tnc 0.000 R0420 G1 225 Y 4 64000159 T1172A T C missense Het probably benign 0.002 0.090 phenotype 05/09/2013
64 36990 UTSW Usp17lb 0.194 R0420 G1 225 Y 7 104840539 C393S A T missense Het probably benign 0.000 0.090 05/09/2013
65 36977 UTSW Usp42 0.000 R0420 G1 225 Y 5 143714861 L1136F G A missense Het probably damaging 0.991 0.647 phenotype 05/09/2013
66 37023 UTSW Vmn2r92 0.099 R0420 G1 82 Y 17 18168921 M499R T G missense Het probably benign 0.015 0.090 05/09/2013
67 37004 UTSW Vps54 0.938 R0420 G1 135 Y 11 21311071 T A splice site Het probably benign phenotype 05/09/2013
68 36999 UTSW Wdr6 0.267 R0420 G1 225 Y 9 108573101 R1076H C T missense Het probably benign 0.414 0.225 phenotype 05/09/2013
69 36996 UTSW Wdr72 0.161 R0420 G1 225 Y 9 74210757 M917K T A missense Het possibly damaging 0.748 0.467 phenotype 05/09/2013
70 36979 UTSW Wee2 0.000 R0420 G1 216 Y 6 40456995 V281A T C missense Het probably benign 0.040 0.090 05/09/2013
71 36962 UTSW Zc3h6 0.352 R0420 G1 174 Y 2 129014827 D609G A G missense Het probably benign 0.004 0.090 05/09/2013
72 36964 UTSW Zfp345 0.145 R0420 G1 225 Y 2 150473243 H125Y G A missense Het possibly damaging 0.738 0.751 05/09/2013
73 37018 UTSW Zhx2 0.261 R0420 G1 225 Y 15 57821840 K202E A G missense Het probably damaging 0.998 0.096 phenotype 05/09/2013
74 66342 UTSW Zic2 0.893 R0420 G1 135 Y 14 122476364 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC small deletion Het probably benign 0.090 phenotype 08/19/2013
[records 1 to 74 of 74]