Incidental Mutations

70 incidental mutations are currently displayed, and affect 70 genes.
13 are Possibly Damaging.
25 are Probably Damaging.
28 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 37043 UTSW 2310050C09Rik 0.081 R0421 G1 225 Y 3 92868984 T131A T C missense Het probably damaging 0.987 0.647 05/09/2013
2 37033 UTSW Abi1 0.757 R0421 G1 225 Y 2 22960827 T195I G A missense Het probably damaging 1.000 0.273 phenotype 05/09/2013
3 37095 UTSW Afap1l1 0.063 R0421 G1 170 Y 18 61751874 N180S T C missense Het probably damaging 0.999 0.132 05/09/2013
4 37081 UTSW Arsg 0.000 R0421 G1 220 Y 11 109527766 Y196C A G missense Het probably damaging 0.997 0.183 phenotype 05/09/2013
5 37076 UTSW Ascc3 0.963 R0421 G1 225 Y 10 50748926 V1637L G T missense Het probably benign 0.023 0.081 phenotype 05/09/2013
6 37056 UTSW Atp2b2 0.904 R0421 G1 198 Y 6 113813888 R185L C A missense Het probably damaging 0.996 0.234 phenotype 05/09/2013
7 37075 UTSW Ccr9 0.081 R0421 G1 225 Y 9 123779606 M118L A T missense Het probably benign 0.000 0.109 phenotype 05/09/2013
8 37086 UTSW Cdh12 0.257 R0421 G1 225 Y 15 21480224 A T critical splice acceptor site Het probably null 0.948 phenotype 05/09/2013
9 37084 UTSW Cdk13 1.000 R0421 G1 225 Y 13 17763170 S763G T C missense Het probably damaging 0.987 0.583 phenotype 05/09/2013
10 37085 UTSW Cenpk 0.836 R0421 G1 225 Y 13 104242403 N177K C A missense Het probably benign 0.357 0.090 phenotype 05/09/2013
11 37097 UTSW Cfap43 0.113 R0421 G1 225 Y 19 47835575 N119T T G missense Het probably benign 0.002 0.090 phenotype 05/09/2013
12 37064 UTSW Chrna6 0.074 R0421 G1 225 Y 8 27408387 E101G T C missense Het probably null 0.978 0.341 phenotype 05/09/2013
13 37074 UTSW Clasp2 0.000 R0421 G1 185 Y 9 113854302 R400H G A missense Het probably benign 0.024 0.129 phenotype 05/09/2013
14 37072 UTSW Col6a6 0.110 R0421 G1 162 Y 9 105784206 M235V T C missense Het probably benign 0.017 0.063 05/09/2013
15 37065 UTSW Ddx49 0.943 R0421 G1 225 Y 8 70295632 L291Q A T missense Het probably damaging 1.000 0.966 05/09/2013
16 37083 UTSW Dhrs7 0.087 R0421 G1 182 Y 12 72653086 A T splice site Het probably benign phenotype 05/09/2013
17 37087 UTSW Dnah5 0.840 R0421 G1 225 Y 15 28229541 K107M A T missense Het possibly damaging 0.787 0.073 phenotype 05/09/2013
18 37091 UTSW Dsg2 0.200 R0421 G1 225 Y 18 20579391 R151C C T missense Het probably damaging 1.000 0.368 phenotype 05/09/2013
19 37038 UTSW Dsn1 0.923 R0421 G1 157 Y 2 157005869 T2A T C missense Het possibly damaging 0.954 0.060 phenotype 05/09/2013
20 37031 UTSW Edem3 0.391 R0421 G1 213 Y 1 151792438 A G splice site Het probably benign 0.090 phenotype 05/09/2013
21 37060 UTSW Eif3c 0.000 R0421 G1 225 Y 7 126563712 N133S T C missense Het possibly damaging 0.955 0.092 phenotype 05/09/2013
22 37063 UTSW F10 1.000 R0421 G1 118 N 8 13045097 K85E A G missense Het probably benign 0.047 phenotype 05/09/2013
23 37030 UTSW Fam129a 0.000 R0421 G1 207 Y 1 151709082 T A splice site Het probably benign 0.090 phenotype 05/09/2013
24 37061 UTSW Fam57b 0.000 R0421 G1 166 Y 7 126825015 V44M G A missense Het probably damaging 0.994 0.655 phenotype 05/09/2013
25 37094 UTSW Fbn2 0.847 R0421 G1 166 Y 18 58027804 T A splice site Het probably benign 0.090 phenotype 05/09/2013
26 37048 UTSW Gtpbp10 0.000 R0421 G1 218 Y 5 5557290 H50Q A T missense Het probably benign 0.001 0.090 phenotype 05/09/2013
27 37066 UTSW Hephl1 0.075 R0421 G1 225 Y 9 15059160 F1013L A G missense Het probably benign 0.053 0.175 05/09/2013
28 37040 UTSW Hps3 0.170 R0421 G1 225 Y 3 20029316 V238F C A missense Het probably benign 0.002 0.090 phenotype 05/09/2013
29 37044 UTSW Kcna10 0.147 R0421 G1 225 Y 3 107194504 K150N A C missense Het probably damaging 0.998 0.324 phenotype 05/09/2013
30 37042 UTSW Kirrel 1.000 R0421 G1 225 Y 3 87083607 G636D C T missense Het probably damaging 0.991 0.450 phenotype 05/09/2013
31 37062 UTSW Kndc1 0.000 R0421 G1 225 Y 7 139908996 R189H G A missense Het probably damaging 1.000 0.647 phenotype 05/09/2013
32 37059 UTSW Knop1 0.000 R0421 G1 90 Y 7 118855629 E50K C T missense Het possibly damaging 0.528 0.179 phenotype 05/09/2013
33 37055 UTSW Kpna7 0.503 R0421 G1 225 Y 5 144989741 H467L T A missense Het possibly damaging 0.820 0.179 phenotype 05/09/2013
34 37034 UTSW Lcn4 0.058 R0421 G1 225 Y 2 26668649 N142D T C missense Het possibly damaging 0.728 0.269 05/09/2013
35 37080 UTSW Map3k3 1.000 R0421 G1 135 Y 11 106148915 T C splice site Het probably benign phenotype 05/09/2013
36 37045 UTSW Mdn1 1.000 R0421 G1 225 Y 4 32684707 T806A A G missense Het probably benign 0.393 0.063 05/09/2013
37 37029 UTSW Nbeal1 0.000 R0421 G1 202 N 1 60268439 N1703K T A missense Het probably benign 0.084 05/09/2013
38 37078 UTSW Neurl4 0.000 R0421 G1 225 Y 11 69908534 V914A T C missense Het probably damaging 0.997 0.075 phenotype 05/09/2013
39 37037 UTSW Nop56 0.963 R0421 G1 225 Y 2 130276772 S275P T C missense Het possibly damaging 0.956 0.366 phenotype 05/09/2013
40 37035 UTSW Olfr352 0.063 R0421 G1 225 Y 2 36869641 E25G A G missense Het possibly damaging 0.895 0.379 phenotype 05/09/2013
41 37058 UTSW Olfr655 0.071 R0421 G1 225 Y 7 104596722 V153A A G missense Het probably benign 0.002 0.090 phenotype 05/09/2013
42 37067 UTSW Olfr868 0.194 R0421 G1 225 Y 9 20101475 K239E A G missense Het probably damaging 0.999 0.381 phenotype 05/09/2013
43 37049 UTSW Otof 0.160 R0421 G1 225 Y 5 30371568 I1827S A C missense Het possibly damaging 0.942 0.452 phenotype 05/09/2013
44 37032 UTSW Pappa2 0.000 R0421 G1 225 Y 1 158848080 I1032N A T missense Het probably damaging 0.998 0.217 phenotype 05/09/2013
45 37052 UTSW Pcdh7 0.257 R0421 G1 224 Y 5 57720060 E319G A G missense Het probably damaging 1.000 0.325 phenotype 05/09/2013
46 37093 UTSW Pcdhb11 0.107 R0421 G1 225 Y 18 37422480 S288T T A missense Het probably benign 0.042 0.090 05/09/2013
47 37071 UTSW Phip 1.000 R0421 G1 198 Y 9 82926457 D488E A T missense Het probably damaging 0.999 0.946 phenotype 05/09/2013
48 37089 UTSW Pla2g7 0.000 R0421 G1 225 Y 17 43611412 H394L A T missense Het probably damaging 0.961 0.685 phenotype 05/09/2013
49 37047 UTSW Plk3 0.000 R0421 G1 208 Y 4 117133444 V69A A G missense Het probably damaging 1.000 0.419 phenotype 05/09/2013
50 37092 UTSW Prob1 0.151 R0421 G1 225 N 18 35653030 A724S C A missense Het possibly damaging 0.705 05/09/2013
51 37096 UTSW Prune2 0.000 R0421 G1 225 Y 19 17123311 F2060L T C missense Het probably benign 0.019 0.060 phenotype 05/09/2013
52 37068 UTSW Rgl3 0.000 R0421 G1 225 Y 9 21976032 R498C G A missense Het probably benign 0.063 0.090 05/09/2013
53 37082 UTSW Rnf213 0.000 R0421 G1 170 N 11 119447257 N3362H A C missense Het probably damaging 0.998 phenotype 05/09/2013
54 37054 UTSW Sbds 1.000 R0421 G1 218 Y 5 130253933 A G unclassified Het probably benign phenotype 05/09/2013
55 37036 UTSW Scn9a 1.000 R0421 G1 87 Y 2 66543277 S453G T C missense Het probably benign 0.000 0.058 phenotype 05/09/2013
56 37077 UTSW Sh3rf3 0.201 R0421 G1 225 Y 10 58984075 L236P T C missense Het probably damaging 0.999 0.396 05/09/2013
57 37046 UTSW Skint1 0.080 R0421 G1 225 Y 4 112019014 N44S A G missense Het possibly damaging 0.740 0.179 phenotype 05/09/2013
58 37050 UTSW Slc5a1 0.168 R0421 G1 225 Y 5 33134652 I141N T A missense Het probably damaging 0.999 0.864 phenotype 05/09/2013
59 37073 UTSW Trank1 0.000 R0421 G1 225 Y 9 111391839 I2548N T A missense Het probably damaging 0.996 0.206 05/09/2013
60 37041 UTSW Tsc22d2 0.551 R0421 G1 225 Y 3 58417328 G A unclassified Het probably benign 0.174 05/09/2013
61 37070 UTSW Unc13c 0.000 R0421 G1 225 Y 9 73933210 I120F T A missense Het possibly damaging 0.764 0.061 phenotype 05/09/2013
62 37053 UTSW Vmn2r11 0.085 R0421 G1 225 Y 5 109059428 I9L T G missense Het probably benign 0.001 0.090 05/09/2013
63 37057 UTSW Vmn2r58 0.405 R0421 G1 225 Y 7 41865204 N114H T G missense Het probably benign 0.017 0.090 05/09/2013
64 37079 UTSW Vps53 1.000 R0421 G1 208 Y 11 76082670 L166P A G missense Het probably damaging 1.000 0.965 phenotype 05/09/2013
65 37090 UTSW Zfp119a 0.000 R0421 G1 225 N 17 55865248 K532* T A nonsense Het probably null 05/09/2013
66 37088 UTSW Zfp472 0.000 R0421 G1 217 Y 17 32975923 T11A A G missense Het possibly damaging 0.707 0.179 05/09/2013
67 37039 UTSW Zfp512b 0.000 R0421 G1 225 Y 2 181588258 K87* T A nonsense Het probably null 0.976 05/09/2013
68 37051 UTSW Zfp518b 0.110 R0421 G1 225 Y 5 38674575 P29L G A missense Het probably damaging 0.999 0.135 05/09/2013
69 37069 UTSW Zfp599 0.077 R0421 G1 225 Y 9 22250547 A G splice site Het probably benign 05/09/2013
70 66343 UTSW Zic2 0.930 R0421 G1 168 Y 14 122476364 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC small deletion Het probably benign 0.090 phenotype 08/19/2013
[records 1 to 70 of 70]