Incidental Mutations

30 incidental mutations are currently displayed, and affect 30 genes.
5 are Possibly Damaging.
13 are Probably Damaging.
10 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 30 of 30] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 56197 UTSW 4931414P19Rik 0.077 R0575 G1 193 Y 14 54591252 S264N C T missense Het possibly damaging 0.617 0.103 07/11/2013
2 56191 UTSW Acsm1 0.000 R0575 G1 98 Y 7 119659201 G A critical splice donor site 1 bp Het probably null 0.860 07/11/2013
3 56199 UTSW Adsl 1.000 R0575 G1 161 Y 15 80963685 A93V C T missense Het probably damaging 1.000 0.537 phenotype 07/11/2013
4 56188 UTSW Agbl5 0.000 R0575 G1 160 Y 5 30894454 S539C A T missense Het probably damaging 0.999 0.175 phenotype 07/11/2013
5 56196 UTSW Aggf1 0.473 R0575 G1 92 Y 13 95368397 T285S T A missense Het probably benign 0.018 0.090 phenotype 07/11/2013
6 56193 UTSW Anapc11 0.871 R0575 G1 181 Y 11 120599366 D36G A G missense Het probably benign 0.001 0.393 07/11/2013
7 56184 UTSW Ankrd44 0.186 R0575 G1 101 Y 1 54762310 A286V G A missense Het probably damaging 0.999 0.089 07/11/2013
8 56201 UTSW Atf7ip2 0.098 R0575 G1 207 Y 16 10237211 G281C G T missense Het probably damaging 1.000 0.113 07/11/2013
9 56204 UTSW Birc6 1.000 R0575 G1 209 Y 17 74689237 K4475E A G missense Het probably damaging 0.997 0.184 phenotype 07/11/2013
10 56205 UTSW Ccbe1 1.000 R0575 G1 191 Y 18 66093995 T A splice site Het probably benign 0.090 phenotype 07/11/2013
11 56189 UTSW Cyp26b1 1.000 R0575 G1 180 Y 6 84575306 A G splice site Het probably benign phenotype 07/11/2013
12 56187 UTSW Dcun1d1 0.679 R0575 G1 159 Y 3 35897785 T C splice site Het probably benign 07/11/2013
13 201512 UTSW Dtwd2 0.123 R0575 G1 56 Y 18 49698472 C156F C A missense Het probably damaging 1.000 0.919 06/16/2014
14 56200 UTSW Efcab6 0.000 R0575 G1 139 Y 15 83967700 I326L T G missense Het probably benign 0.283 0.090 phenotype 07/11/2013
15 60442 UTSW Extl1 0.306 R0575 G1 195 Y 4 134357677 TGCGTTGCACCGATACCGGG TG unclassified Het probably benign 0.090 phenotype 07/11/2013
16 56185 UTSW F5 1.000 R0575 G1 118 Y 1 164176244 Q203K C A missense Het probably damaging 0.999 0.115 phenotype 07/11/2013
17 201510 UTSW Frs3 0.557 R0575 G1 69 Y 17 47703723 H447R A G missense Het possibly damaging 0.890 0.086 phenotype 06/16/2014
18 201509 UTSW Gmds 1.000 R0575 G1 66 Y 13 31940583 Q264P T G missense Het probably damaging 1.000 0.969 phenotype 06/16/2014
19 56202 UTSW Golgb1 0.885 R0575 G1 181 Y 16 36918809 D2503E T A missense Het probably benign 0.000 0.090 phenotype 07/11/2013
20 56190 UTSW Lgi4 1.000 R0575 G1 225 Y 7 31060093 G25R G A missense Het probably benign 0.120 0.064 phenotype 07/11/2013
21 201508 UTSW Olfr10 0.087 R0575 G1 77 Y 11 49318053 C169Y G A missense Het probably damaging 1.000 0.337 phenotype 06/16/2014
22 56206 UTSW Olfr1461 0.086 R0575 G1 174 Y 19 13165387 Y124* T A nonsense Het probably null 0.976 phenotype 07/11/2013
23 56198 UTSW Pcdh20 0.000 R0575 G1 204 Y 14 88467612 S751P A G missense Het probably damaging 1.000 0.494 phenotype 07/11/2013
24 56194 UTSW Pcnx4 0.170 R0575 G1 148 Y 12 72567236 T652A A G missense Het probably benign 0.003 0.059 07/11/2013
25 56195 UTSW Pom121l2 0.072 R0575 G1 225 Y 13 21984168 F870V T G missense Het probably damaging 0.990 0.394 07/11/2013
26 201511 UTSW Prob1 0.183 R0575 G1 39 Y 18 35654721 D160G T C missense Het possibly damaging 0.845 0.084 06/16/2014
27 56192 UTSW Spa17 0.120 R0575 G1 129 Y 9 37603393 K133E T C missense Het probably damaging 0.986 0.148 phenotype 07/11/2013
28 56186 UTSW Strbp 0.493 R0575 G1 225 Y 2 37640873 D123V T A missense Het possibly damaging 0.869 0.194 phenotype 07/11/2013
29 56203 UTSW Tnxb 0.000 R0575 G1 124 Y 17 34717206 T3586A A G missense Het possibly damaging 0.907 0.098 phenotype 07/11/2013
30 56207 UTSW Zfp518a 0.917 R0575 G1 181 Y 19 40912315 H229Q T A missense Het probably damaging 0.999 0.131 phenotype 07/11/2013
[records 1 to 30 of 30]