Incidental Mutations

36 incidental mutations are currently displayed, and affect 36 genes.
1 are Possibly Damaging.
9 are Probably Damaging.
22 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 36 of 36] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 60440 UTSW Atg2a 0.475 R0592 G1 217 Y 19 6245007 GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC unclassified Het probably benign 0.090 07/11/2013
2 56012 UTSW Bbs7 0.000 R0592 G1 225 Y 3 36610297 V53D A T missense Het probably benign 0.051 0.090 phenotype 07/11/2013
3 56013 UTSW Bglap 0.158 R0592 G1 198 Y 3 88383655 I90F T A missense Het probably benign 0.011 0.090 phenotype 07/11/2013
4 172367 UTSW C2cd4b 0.000 R0592 G1 69 Y 9 67760691 R323H G A missense Het probably damaging 1.000 0.647 04/14/2014
5 56026 UTSW Cdh5 1.000 R0592 G1 166 Y 8 104130902 T A splice site Het probably null 0.976 phenotype 07/11/2013
6 56025 UTSW Cdh8 0.000 R0592 G1 225 Y 8 99279478 D159V T A missense Het probably damaging 1.000 0.963 phenotype 07/11/2013
7 56010 UTSW Dnah7a 0.140 R0592 G1 202 Y 1 53456612 Y3229H A G missense Het possibly damaging 0.909 0.239 07/11/2013
8 56035 UTSW Dzip1 0.472 R0592 G1 186 Y 14 118902139 E381G T C missense Het probably damaging 0.998 0.113 phenotype 07/11/2013
9 56027 UTSW Elmod1 0.000 R0592 G1 225 Y 9 53926106 A G splice site Het probably benign 0.090 phenotype 07/11/2013
10 56018 UTSW Exosc10 0.968 R0592 G1 225 Y 4 148581113 S811P T C missense Het probably benign 0.000 0.061 phenotype 07/11/2013
11 56017 UTSW Fhl3 0.432 R0592 G1 126 Y 4 124705677 Y15C A G missense Het probably benign 0.233 0.105 phenotype 07/11/2013
12 56032 UTSW Gstz1 0.000 R0592 G1 107 Y 12 87163721 S126N G A missense Het probably benign 0.000 0.090 phenotype 07/11/2013
13 56028 UTSW Hey2 0.885 R0592 G1 225 Y 10 30833957 A267S C A missense Het probably benign 0.444 0.083 phenotype 07/11/2013
14 56021 UTSW Iqce 0.000 R0592 G1 169 Y 5 140686107 A T unclassified Het probably null 0.976 07/11/2013
15 56040 UTSW Katnal2 0.000 R0592 G1 115 Y 18 77002560 A T splice site Het probably null 0.976 07/11/2013
16 56020 UTSW Kdm2b 1.000 R0592 G1 194 Y 5 122961134 G A splice site Het probably benign phenotype 07/11/2013
17 56037 UTSW Mov10l1 0.264 R0592 G1 133 Y 15 88998766 A G critical splice acceptor site Het probably null 0.949 phenotype 07/11/2013
18 56024 UTSW Numa1 1.000 R0592 G1 206 Y 7 102013897 T724A A G missense Het probably benign 0.000 0.090 phenotype 07/11/2013
19 56019 UTSW Oas3 0.074 R0592 G1 144 Y 5 120771149 F244S A G missense Het probably damaging 1.000 0.786 phenotype 07/11/2013
20 56041 UTSW Olfr1472 0.277 R0592 G1 225 Y 19 13453705 I271V T C missense Het probably benign 0.002 0.090 phenotype 07/11/2013
21 172366 UTSW Olfr715 0.224 R0592 G1 43 Y 7 107129343 L17F G A missense Het probably benign 0.024 0.155 phenotype 04/14/2014
22 56038 UTSW Ppil2 0.000 R0592 G1 209 Y 16 17107219 S30P A G missense Het probably benign 0.000 0.090 phenotype 07/11/2013
23 56031 UTSW Rab37 0.080 R0592 G1 225 Y 11 115160523 T G splice site Het probably benign phenotype 07/11/2013
24 56039 UTSW Riox2 0.743 R0592 G1 217 Y 16 59489579 T C unclassified Het probably benign phenotype 07/11/2013
25 56011 UTSW Ryr3 0.573 R0592 G1 201 Y 2 112678481 S3358P A G missense Het probably damaging 1.000 0.241 phenotype 07/11/2013
26 172368 UTSW Sash1 1.000 R0592 G1 71 Y 10 8729782 H948L T A missense Het probably benign 0.003 0.079 phenotype 04/14/2014
27 56034 UTSW Serpinb6e 0.117 R0592 G1 205 Y 13 33841074 N78I T A missense Het probably damaging 1.000 0.974 07/11/2013
28 56033 UTSW Slc25a47 0.000 R0592 G1 171 Y 12 108854258 V63M G A missense Het probably damaging 0.982 0.215 07/11/2013
29 56014 UTSW Slc9b1 0.106 R0592 G1 225 Y 3 135394074 A T splice site Het probably benign phenotype 07/11/2013
30 56022 UTSW Strip2 0.114 R0592 G1 225 Y 6 29931210 S387T T A missense Het probably benign 0.275 0.081 07/11/2013
31 56023 UTSW Tcaf3 0.052 R0592 G1 166 Y 6 42596843 N145S T C missense Het probably benign 0.157 0.090 07/11/2013
32 56015 UTSW Tex10 0.955 R0592 G1 225 Y 4 48456800 R637Q C T missense Het probably benign 0.035 0.090 phenotype 07/11/2013
33 56036 UTSW Trmu 0.158 R0592 G1 142 Y 15 85896826 T C unclassified Het probably benign 0.090 phenotype 07/11/2013
34 56029 UTSW Vezf1 1.000 R0592 G1 187 N 11 88068435 A T critical splice donor site Het probably benign phenotype 07/11/2013
35 67037 UTSW Vmn2r116 0.067 R0592 G1 197 Y 17 23386915 T267I C T missense Het probably damaging 0.991 0.647 phenotype 08/20/2013
36 56016 UTSW Whrn 0.000 R0592 G1 203 Y 4 63415567 A450S C A missense Het probably damaging 1.000 0.534 phenotype 07/11/2013
[records 1 to 36 of 36]