Incidental Mutations

37 incidental mutations are currently displayed, and affect 37 genes.
4 are Possibly Damaging.
8 are Probably Damaging.
20 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 37 of 37] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 61648 UTSW 2310003L06Rik 0.074 R0676 G1 123 Y 5 87964657 A G unclassified Het probably benign 0.090 07/30/2013
2 201529 UTSW Arhgef25 0.224 R0676 G1 73 Y 10 127184010 A G critical splice donor site 2 bp Het probably null 0.950 phenotype 06/19/2014
3 201533 UTSW B3galnt2 1.000 R0676 G1 63 Y 13 13995793 S243P T C missense Het probably benign 0.000 phenotype 06/19/2014
4 61660 UTSW Col11a2 0.900 R0676 G1 95 Y 17 34057275 N799D A G missense Het probably damaging 0.989 0.078 phenotype 07/30/2013
5 201522 UTSW Cpb1 0.000 R0676 G1 57 Y 3 20266533 T C splice site Het probably null 0.976 phenotype 06/19/2014
6 98971 UTSW Crot 0.105 R0676 G1 145 Y 5 8993622 A C utr 5 prime Het probably benign 0.090 phenotype 01/10/2014
7 61655 UTSW Ctnna3 0.233 R0676 G1 205 Y 10 64409261 H451P A C missense Het probably benign 0.204 0.635 phenotype 07/30/2013
8 61657 UTSW Cts6 0.000 R0676 G1 92 Y 13 61197484 C T splice site Het probably benign 07/30/2013
9 61656 UTSW Dock2 0.000 R0676 G1 135 Y 11 34695236 T540A T C missense Het probably damaging 0.990 0.296 phenotype 07/30/2013
10 61651 UTSW Dysf 0.000 R0676 G1 120 Y 6 84113336 F956L C A missense Het probably benign 0.074 0.090 phenotype 07/30/2013
11 61654 UTSW Gabrg3 0.000 R0676 G1 128 Y 7 56724421 Y466N A T missense Het probably damaging 0.987 0.188 phenotype 07/30/2013
12 61658 UTSW Gm10845 0.084 R0676 G1 123 Y 14 79863204 T A exon Het noncoding transcript 0.087 07/30/2013
13 201537 UTSW H2-M5 0.000 R0676 G1 44 Y 17 36989142 F47L A G missense Het possibly damaging 0.954 0.179 06/19/2014
14 201534 UTSW Hist1h4i 0.687 R0676 G1 42 Y 13 22041106 T C unclassified 4761 bp Het probably null 0.957 phenotype 06/19/2014
15 61643 UTSW Il1rl1 0.000 R0676 G1 155 Y 1 40442574 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG splice site Het probably benign 0.090 phenotype 07/30/2013
16 61650 UTSW Immt 0.924 R0676 G1 118 Y 6 71851844 S128G A G missense Het probably benign 0.217 0.090 07/30/2013
17 201526 UTSW Klb 0.902 R0676 G1 42 Y 5 65379055 D576V A T missense Het probably damaging 1.000 0.847 phenotype 06/19/2014
18 201532 UTSW Lpin1 0.378 R0676 G1 32 Y 12 16540979 N817K A T missense Het possibly damaging 0.877 0.082 phenotype 06/19/2014
19 201528 UTSW Lrrk1 1.000 R0676 G1 74 Y 7 66294981 R627H C T missense Het probably damaging 1.000 0.264 phenotype 06/19/2014
20 61647 UTSW Luzp1 0.848 R0676 G1 120 Y 4 136542685 K740E A G missense Het probably damaging 0.967 0.069 phenotype 07/30/2013
21 201531 UTSW Mapk9 0.276 R0676 G1 67 Y 11 49883156 *382Q T C makesense Het probably null 0.975 phenotype 06/19/2014
22 61649 UTSW Mn1 1.000 R0676 G1 225 Y 5 111421034 S957G A G missense Het possibly damaging 0.522 0.096 phenotype 07/30/2013
23 61653 UTSW Mrgprb8 0.000 R0676 G1 136 Y 7 48388664 M28L A T missense Het probably benign 0.000 0.090 07/30/2013
24 201530 UTSW Myo1a 0.159 R0676 G1 46 Y 10 127719880 I913V A G missense Het probably benign 0.016 0.089 phenotype 06/19/2014
25 61663 UTSW Nolc1 0.000 R0676 G1 109 Y 19 46080089 T A splice site Het probably benign 0.090 07/30/2013
26 61646 UTSW Pde4dip 1.000 R0676 G1 107 Y 3 97717097 A C splice site Het probably benign phenotype 07/30/2013
27 201525 UTSW Rbpj 1.000 R0676 G1 70 Y 5 53646048 C T splice site Het probably benign phenotype 06/19/2014
28 201539 UTSW Ric1 0.492 R0676 G1 36 Y 19 29577647 I387T T C missense Het probably benign 0.000 0.059 06/19/2014
29 61652 UTSW Ruvbl1 0.969 R0676 G1 135 Y 6 88473200 R58G A G missense Het probably damaging 1.000 0.599 phenotype 07/30/2013
30 201527 UTSW Scarb1 0.000 R0676 G1 37 Y 5 125297214 C A unclassified Het probably benign 0.090 phenotype 06/19/2014
31 201524 UTSW Sh3tc1 0.111 R0676 G1 56 Y 5 35719114 A T splice site Het probably benign 0.090 06/19/2014
32 201535 UTSW Slc22a23 0.196 R0676 G1 66 Y 13 34195479 T435I G A missense Het probably damaging 0.976 0.647 phenotype 06/19/2014
33 201538 UTSW Slc22a26 0.054 R0676 G1 35 Y 19 7796144 A T splice site Het probably benign 0.090 06/19/2014
34 61662 UTSW Taf6l 0.965 R0676 G1 108 Y 19 8773369 I114V T C missense Het probably benign 0.001 0.090 phenotype 07/30/2013
35 61664 UTSW Tbc1d8b 0.106 R0676 G1 102 Y X 139712276 S284G A G missense Het possibly damaging 0.768 0.088 phenotype 07/30/2013
36 201523 UTSW Tmem131l 0.166 R0676 G1 48 Y 3 83934815 C T splice site Het probably benign 06/19/2014
37 201536 UTSW Vmn2r115 0.253 R0676 G1 22 Y 17 23346264 S375F C T missense Het probably benign 0.190 0.090 06/19/2014
[records 1 to 37 of 37]