Incidental Mutations

30 incidental mutations are currently displayed, and affect 30 genes.
7 are Possibly Damaging.
12 are Probably Damaging.
10 are Probably Benign.
1 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 30 of 30] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 61163 UTSW 1700074P13Rik 0.054 R0686 G1 115 N 6 40928518 S68F G A missense Het probably damaging 0.991 07/30/2013
2 61161 UTSW 1700123K08Rik 0.055 R0686 G1 224 N 5 138564537 E42K C T missense Het possibly damaging 0.697 07/30/2013
3 61176 UTSW Arhgef12 0.950 R0686 G1 108 N 9 42993028 L718R A C missense Het probably benign 0.024 phenotype 07/30/2013
4 61175 UTSW Bsx 0.000 R0686 G1 87 N 9 40876437 S136A T G missense Het probably damaging 1.000 phenotype 07/30/2013
5 61157 UTSW Ccne2 0.000 R0686 G1 188 N 4 11197220 M174K T A missense Het possibly damaging 0.934 phenotype 07/30/2013
6 61172 UTSW Ces1a 0.000 R0686 G1 161 N 8 93022449 Y445H A G missense Het probably damaging 1.000 07/30/2013
7 61181 UTSW Ckb 0.000 R0686 G1 95 N 12 111670193 V249A A G missense Het probably benign 0.424 phenotype 07/30/2013
8 61159 UTSW Crybg2 0.826 R0686 G1 107 N 4 134074526 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG small deletion Het probably benign 07/30/2013
9 61170 UTSW Cyp2r1 0.000 R0686 G1 128 N 7 114552011 M358L T G missense Het possibly damaging 0.518 phenotype 07/30/2013
10 61160 UTSW Dnah10 0.000 R0686 G1 94 N 5 124747718 I646T T C missense Het possibly damaging 0.948 phenotype 07/30/2013
11 61166 UTSW Eps8l1 0.000 R0686 G1 91 N 7 4477450 D563E T A missense Het probably benign 0.363 phenotype 07/30/2013
12 61156 UTSW Fam102b 0.266 R0686 G1 87 N 3 108992685 R116C G A missense Het probably damaging 1.000 0.460 07/30/2013
13 61168 UTSW Fam160a2 0.000 R0686 G1 106 N 7 105388309 L356I G T missense Het probably damaging 1.000 phenotype 07/30/2013
14 61186 UTSW Fpr-rs4 0.103 R0686 G1 119 N 17 18022351 I207L A C missense Het probably benign 0.054 07/30/2013
15 61171 UTSW Fus 1.000 R0686 G1 143 N 7 127972763 G A unclassified Het probably benign phenotype 07/30/2013
16 61187 UTSW Gm340 0.086 R0686 G1 97 N 19 41582372 S1R T A missense Het possibly damaging 0.734 07/30/2013
17 61177 UTSW Ireb2 0.000 R0686 G1 90 N 9 54904176 I755L A T missense Het probably benign 0.445 phenotype 07/30/2013
18 61185 UTSW Kctd9 0.000 R0686 G1 93 N 14 67728736 T101A A G missense Het probably damaging 0.996 07/30/2013
19 61165 UTSW Ltbr 0.137 R0686 G1 137 N 6 125308061 D292G T C missense Het possibly damaging 0.880 phenotype 07/30/2013
20 61180 UTSW Med1 1.000 R0686 G1 115 N 11 98158404 T507I G A missense Het probably damaging 1.000 phenotype 07/30/2013
21 61184 UTSW Msh3 0.400 R0686 G1 95 N 13 92351431 P93S G A missense Het possibly damaging 0.534 phenotype 07/30/2013
22 61169 UTSW Olfr705 0.266 R0686 G1 174 N 7 106714378 M101K A T missense Het probably damaging 0.984 phenotype 07/30/2013
23 61174 UTSW Olfr970 0.321 R0686 G1 91 N 9 39819668 T10P A C missense Het probably damaging 0.983 phenotype 07/30/2013
24 61178 UTSW Paqr5 0.126 R0686 G1 109 N 9 61972794 T59P T G missense Het probably benign 0.001 07/30/2013
25 61167 UTSW Pih1d1 0.449 R0686 G1 97 N 7 45156329 L74* T A nonsense Het probably null 07/30/2013
26 61154 UTSW Prim2 0.931 R0686 G1 111 N 1 33514189 T264A T C missense Het probably benign 0.000 phenotype 07/30/2013
27 61158 UTSW Rasef 0.080 R0686 G1 133 N 4 73734534 S577P A G missense Het probably damaging 1.000 phenotype 07/30/2013
28 61183 UTSW Simc1 0.066 R0686 G1 90 N 13 54525190 S450R T A missense Het probably benign 0.306 07/30/2013
29 61188 UTSW Tdrd1 0.367 R0686 G1 90 N 19 56856051 N796I A T missense Het probably damaging 1.000 phenotype 07/30/2013
30 61182 UTSW Vmn1r214 0.055 R0686 G1 100 N 13 23034792 I152N T A missense Het probably damaging 1.000 07/30/2013
[records 1 to 30 of 30]