Incidental Mutations

30 incidental mutations are currently displayed, and affect 30 genes.
7 are Possibly Damaging.
12 are Probably Damaging.
10 are Probably Benign.
1 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 30 of 30] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 61163 UTSW 1700074P13Rik 0.055 R0686 G1 115 N 6 40928518 S68F G A missense Het probably damaging 0.991 07/30/2013
2 61161 UTSW 1700123K08Rik 0.055 R0686 G1 224 N 5 138564537 E42K C T missense Het possibly damaging 0.697 07/30/2013
3 61176 UTSW Arhgef12 0.947 R0686 G1 108 N 9 42993028 L718R A C missense Het probably benign 0.024 phenotype 07/30/2013
4 61175 UTSW Bsx 0.000 R0686 G1 87 N 9 40876437 S136A T G missense Het probably damaging 1.000 phenotype 07/30/2013
5 61157 UTSW Ccne2 0.000 R0686 G1 188 N 4 11197220 M174K T A missense Het possibly damaging 0.934 phenotype 07/30/2013
6 61172 UTSW Ces1a 0.000 R0686 G1 161 N 8 93022449 Y445H A G missense Het probably damaging 1.000 07/30/2013
7 61181 UTSW Ckb 0.000 R0686 G1 95 N 12 111670193 V249A A G missense Het probably benign 0.424 phenotype 07/30/2013
8 61159 UTSW Crybg2 0.820 R0686 G1 107 N 4 134074526 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG small deletion Het probably benign 07/30/2013
9 61170 UTSW Cyp2r1 0.000 R0686 G1 128 N 7 114552011 M358L T G missense Het possibly damaging 0.518 phenotype 07/30/2013
10 61160 UTSW Dnah10 0.000 R0686 G1 94 N 5 124747718 I646T T C missense Het possibly damaging 0.948 phenotype 07/30/2013
11 61166 UTSW Eps8l1 0.000 R0686 G1 91 N 7 4477450 D563E T A missense Het probably benign 0.363 phenotype 07/30/2013
12 61156 UTSW Fam102b 0.210 R0686 G1 87 N 3 108992685 R116C G A missense Het probably damaging 1.000 0.460 07/30/2013
13 61168 UTSW Fam160a2 0.000 R0686 G1 106 N 7 105388309 L356I G T missense Het probably damaging 1.000 phenotype 07/30/2013
14 61186 UTSW Fpr-rs4 0.121 R0686 G1 119 N 17 18022351 I207L A C missense Het probably benign 0.054 07/30/2013
15 61171 UTSW Fus 1.000 R0686 G1 143 N 7 127972763 G A unclassified Het probably benign phenotype 07/30/2013
16 61187 UTSW Gm340 0.152 R0686 G1 97 N 19 41582372 S1R T A missense Het possibly damaging 0.734 07/30/2013
17 61177 UTSW Ireb2 0.000 R0686 G1 90 N 9 54904176 I755L A T missense Het probably benign 0.445 phenotype 07/30/2013
18 61185 UTSW Kctd9 0.000 R0686 G1 93 N 14 67728736 T101A A G missense Het probably damaging 0.996 07/30/2013
19 61165 UTSW Ltbr 0.137 R0686 G1 137 N 6 125308061 D292G T C missense Het possibly damaging 0.880 phenotype 07/30/2013
20 61180 UTSW Med1 1.000 R0686 G1 115 N 11 98158404 T507I G A missense Het probably damaging 1.000 phenotype 07/30/2013
21 61184 UTSW Msh3 0.243 R0686 G1 95 N 13 92351431 P93S G A missense Het possibly damaging 0.534 phenotype 07/30/2013
22 61169 UTSW Olfr705 0.223 R0686 G1 174 N 7 106714378 M101K A T missense Het probably damaging 0.984 phenotype 07/30/2013
23 61174 UTSW Olfr970 0.260 R0686 G1 91 N 9 39819668 T10P A C missense Het probably damaging 0.983 phenotype 07/30/2013
24 61178 UTSW Paqr5 0.236 R0686 G1 109 N 9 61972794 T59P T G missense Het probably benign 0.001 07/30/2013
25 61167 UTSW Pih1d1 0.411 R0686 G1 97 N 7 45156329 L74* T A nonsense Het probably null 07/30/2013
26 61154 UTSW Prim2 0.919 R0686 G1 111 N 1 33514189 T264A T C missense Het probably benign 0.000 phenotype 07/30/2013
27 61158 UTSW Rasef 0.077 R0686 G1 133 N 4 73734534 S577P A G missense Het probably damaging 1.000 phenotype 07/30/2013
28 61183 UTSW Simc1 0.077 R0686 G1 90 N 13 54525190 S450R T A missense Het probably benign 0.306 07/30/2013
29 61188 UTSW Tdrd1 0.391 R0686 G1 90 N 19 56856051 N796I A T missense Het probably damaging 1.000 phenotype 07/30/2013
30 61182 UTSW Vmn1r214 0.064 R0686 G1 100 N 13 23034792 I152N T A missense Het probably damaging 1.000 07/30/2013
[records 1 to 30 of 30]