Incidental Mutations

45 incidental mutations are currently displayed, and affect 45 genes.
6 are Possibly Damaging.
17 are Probably Damaging.
14 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 45 of 45] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 70564 UTSW A930011G23Rik 0.115 R0738 G1 225 Y 5 99240953 M189K A T missense Het probably benign 0.075 0.081 09/30/2013
2 70576 UTSW Ank1 0.757 R0738 G1 225 Y 8 23114114 E964D A T missense Het probably damaging 0.982 0.647 phenotype 09/30/2013
3 70591 UTSW Ankhd1 0.000 R0738 G1 225 Y 18 36645249 A G splice site Het probably benign 09/30/2013
4 70572 UTSW Cd9 0.200 R0738 G1 225 Y 6 125462140 Q169K G T missense Het probably benign 0.001 0.090 phenotype 09/30/2013
5 70555 UTSW Cdc42bpa 0.564 R0738 G1 225 Y 1 179999462 T A splice site Het probably benign phenotype 09/30/2013
6 70596 UTSW Ch25h 0.550 R0738 G1 225 Y 19 34474387 N247S T C missense Het possibly damaging 0.899 0.060 phenotype 09/30/2013
7 70569 UTSW Dctn1 1.000 R0738 G1 225 Y 6 83190107 T C critical splice donor site 2 bp Het probably null 0.960 phenotype 09/30/2013
8 70575 UTSW Defa22 0.046 R0738 G1 100 N 8 21162375 T19I C T missense Het probably benign 0.002 09/30/2013
9 70590 UTSW Dscam 1.000 R0738 G1 206 Y 16 96819781 N576D T C missense Het possibly damaging 0.479 0.070 phenotype 09/30/2013
10 70589 UTSW Epha3 0.415 R0738 G1 225 Y 16 63595612 M675V T C missense Het probably damaging 0.996 0.548 phenotype 09/30/2013
11 70562 UTSW Fam241a 0.244 R0738 G1 225 Y 3 127870793 A120S C A missense Het possibly damaging 0.635 0.058 09/30/2013
12 70579 UTSW Fkbp8 1.000 R0738 G1 225 Y 8 70529670 I86N T A missense Het probably damaging 1.000 0.279 phenotype 09/30/2013
13 70584 UTSW Herc4 0.750 R0738 G1 188 Y 10 63289149 P514L C T missense Het possibly damaging 0.934 0.138 phenotype 09/30/2013
14 474092 UTSW Ide 0.000 R0738 G1 225 N 19 37277965 L813* A T nonsense Het probably null phenotype 04/14/2017
15 474088 UTSW Igkv12-41 0.391 R0738 G1 225 N 6 69858691 Q26* G A nonsense Het probably null 04/14/2017
16 70585 UTSW Itsn2 0.000 R0738 G1 225 Y 12 4635681 V483A T C missense Het probably benign 0.174 0.059 phenotype 09/30/2013
17 70567 UTSW Kcp 0.166 R0738 G1 225 Y 6 29490439 I1002N A T missense Het probably benign 0.237 0.090 phenotype 09/30/2013
18 70586 UTSW Lrfn5 0.084 R0738 G1 225 Y 12 61840592 E389* G T nonsense Het probably null 0.976 phenotype 09/30/2013
19 70573 UTSW Lrp6 0.964 R0738 G1 225 Y 6 134542045 A19E G T missense Het probably benign 0.128 0.106 phenotype 09/30/2013
20 70566 UTSW Mad1l1 1.000 R0738 G1 93 Y 5 140300560 L228P A G missense Het probably damaging 1.000 0.516 phenotype 09/30/2013
21 70554 UTSW Map2 0.780 R0738 G1 225 Y 1 66425189 T C splice site Het probably benign phenotype 09/30/2013
22 70565 UTSW Med13l 0.962 R0738 G1 225 Y 5 118751633 Y1820N T A missense Het probably damaging 0.990 0.327 phenotype 09/30/2013
23 70568 UTSW Mgam 0.101 R0738 G1 225 Y 6 40754935 N735S A G missense Het probably benign 0.012 0.082 phenotype 09/30/2013
24 70598 UTSW Mid2 0.166 R0738 G1 222 Y X 140763676 Y618C A G missense Het probably damaging 0.999 0.809 phenotype 09/30/2013
25 70561 UTSW Mllt11 0.196 R0738 G1 225 Y 3 95220286 Q58* G A nonsense Het probably null 0.975 phenotype 09/30/2013
26 70563 UTSW Mttp 0.797 R0738 G1 225 Y 3 138103313 V678A A G missense Het probably damaging 0.999 0.414 phenotype 09/30/2013
27 70593 UTSW Nfatc1 1.000 R0738 G1 225 Y 18 80697910 S278P A G missense Het probably damaging 1.000 0.150 phenotype 09/30/2013
28 70570 UTSW Ninj2 0.000 R0738 G1 221 Y 6 120198137 A G splice site Het probably benign phenotype 09/30/2013
29 70577 UTSW Nsd3 0.187 R0738 G1 225 Y 8 25678709 T A splice site Het probably null 0.976 phenotype 09/30/2013
30 70595 UTSW Olfr1454 0.074 R0738 G1 225 Y 19 13063738 E109V A T missense Het probably damaging 1.000 0.647 phenotype 09/30/2013
31 70582 UTSW Olfr895 0.125 R0738 G1 225 Y 9 38269125 V204A T C missense Het possibly damaging 0.931 0.179 phenotype 09/30/2013
32 70592 UTSW Pcdhb4 0.073 R0738 G1 225 Y 18 37308711 N358S A G missense Het probably damaging 0.998 0.208 09/30/2013
33 70560 UTSW Plch1 0.132 R0738 G1 225 Y 3 63702553 T C intron Het probably benign phenotype 09/30/2013
34 70583 UTSW Popdc3 0.000 R0738 G1 225 Y 10 45315258 L155P T C missense Het probably damaging 1.000 0.963 phenotype 09/30/2013
35 70574 UTSW Ptpro 0.000 R0738 G1 225 Y 6 137443594 V1007D T A missense Het probably damaging 1.000 0.920 phenotype 09/30/2013
36 70588 UTSW Rbm26 0.657 R0738 G1 213 Y 14 105176782 I24N A T missense Het unknown 0.446 09/30/2013
37 70559 UTSW Rc3h2 0.000 R0738 G1 225 Y 2 37405374 D210V T A missense Het probably damaging 1.000 0.766 phenotype 09/30/2013
38 70580 UTSW Samd1 0.897 R0738 G1 113 N 8 83998996 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA unclassified Het probably benign 09/30/2013
39 70557 UTSW Spopl 0.000 R0738 G1 225 Y 2 23537521 T200A T C missense Het probably benign 0.044 0.117 phenotype 09/30/2013
40 70581 UTSW Tarbp1 0.000 R0738 G1 181 Y 8 126438801 A G critical splice donor site 2 bp Het probably null 0.958 phenotype 09/30/2013
41 70556 UTSW Thnsl1 0.097 R0738 G1 120 Y 2 21213362 H121Q T A missense Het probably damaging 1.000 0.647 09/30/2013
42 70578 UTSW Tll1 1.000 R0738 G1 225 Y 8 64101950 D233G T C missense Het probably damaging 0.996 0.507 phenotype 09/30/2013
43 70571 UTSW Vmn2r27 0.065 R0738 G1 225 Y 6 124223702 V432E A T missense Het possibly damaging 0.481 0.179 09/30/2013
44 70558 UTSW Wdr5 0.966 R0738 G1 225 Y 2 27519412 S49P T C missense Het probably damaging 0.999 0.828 phenotype 09/30/2013
45 70587 UTSW Zfyve26 0.000 R0738 G1 225 Y 12 79295534 I46N A T missense Het probably damaging 0.996 0.108 phenotype 09/30/2013
[records 1 to 45 of 45]