Incidental Mutations

95 incidental mutations are currently displayed, and affect 95 genes.
16 are Possibly Damaging.
31 are Probably Damaging.
39 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 95 of 95] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 70868 UTSW 1700113H08Rik 0.054 R0744 G1 225 Y 10 87165069 L41P T C missense Het probably damaging 0.995 0.647 09/30/2013
2 70889 UTSW A930003A15Rik 0.134 R0744 G1 225 Y 16 19883872 T C intron Het noncoding transcript 0.084 09/30/2013
3 70873 UTSW Abca8a 0.089 R0744 G1 225 Y 11 110040564 D1253E A T missense Het possibly damaging 0.906 0.179 09/30/2013
4 70851 UTSW Acsm3 0.000 R0744 G1 225 Y 7 119777100 I350T T C missense Het possibly damaging 0.839 0.397 phenotype 09/30/2013
5 70887 UTSW Adcy9 0.589 R0744 G1 225 Y 16 4419271 D92G T C missense Het possibly damaging 0.690 0.079 phenotype 09/30/2013
6 70846 UTSW Aebp2 1.000 R0744 G1 225 Y 6 140642364 T G splice site 6 bp Het probably null 0.976 phenotype 09/30/2013
7 70847 UTSW AI987944 0.099 R0744 G1 225 Y 7 41376859 Y6C T C missense Het probably damaging 1.000 0.647 09/30/2013
8 70866 UTSW Ascc3 0.958 R0744 G1 225 Y 10 50845666 W2072R T C missense Het probably benign 0.165 0.365 phenotype 09/30/2013
9 70896 UTSW Asxl3 0.456 R0744 G1 225 Y 18 22516040 D362G A G missense Het probably damaging 1.000 0.647 09/30/2013
10 70842 UTSW Baiap2l1 0.000 R0744 G1 225 Y 5 144266641 D479V T A missense Het probably benign 0.207 0.098 phenotype 09/30/2013
11 70878 UTSW Bdp1 1.000 R0744 G1 225 Y 13 100035825 H2094Q A T missense Het probably benign 0.008 0.090 phenotype 09/30/2013
12 70872 UTSW Bptf 1.000 R0744 G1 225 Y 11 107110812 C A critical splice donor site 1 bp Het probably null 0.960 phenotype 09/30/2013
13 70897 UTSW Camk4 0.095 R0744 G1 225 Y 18 32939454 S20I G T missense Het unknown 0.118 phenotype 09/30/2013
14 70862 UTSW Ccdc36 0.083 R0744 G1 225 Y 9 108404801 C563S A T missense Het probably benign 0.000 0.090 09/30/2013
15 70869 UTSW Ccdc85a 0.239 R0744 G1 127 Y 11 28583296 I83F T A missense Het probably damaging 0.997 0.717 09/30/2013
16 70814 UTSW Ccnt2 1.000 R0744 G1 225 Y 1 127802394 M336K T A missense Het probably benign 0.424 0.085 phenotype 09/30/2013
17 70852 UTSW Cd209e 0.050 R0744 G1 225 Y 8 3853205 D62E G T missense Het probably benign 0.003 0.090 phenotype 09/30/2013
18 70901 UTSW Cd226 0.000 R0744 G1 222 Y 18 89207020 A C intron Het probably benign phenotype 09/30/2013
19 70837 UTSW Clip1 0.000 R0744 G1 225 Y 5 123630721 D605G T C missense Het probably benign 0.048 0.090 phenotype 09/30/2013
20 70858 UTSW Crtc1 0.383 R0744 G1 225 Y 8 70393013 V306A A G missense Het probably benign 0.005 0.090 phenotype 09/30/2013
21 70875 UTSW D130043K22Rik 0.000 R0744 G1 225 Y 13 24863580 G A splice site Het probably benign phenotype 09/30/2013
22 70898 UTSW Dmxl1 0.949 R0744 G1 160 Y 18 49833148 V20A T C missense Het probably damaging 1.000 0.197 phenotype 09/30/2013
23 70893 UTSW Dzip3 1.000 R0744 G1 225 Y 16 48959675 Y301H A G missense Het probably damaging 0.999 0.136 phenotype 09/30/2013
24 70841 UTSW Ephb4 1.000 R0744 G1 225 Y 5 137365667 N600K T A missense Het probably damaging 1.000 0.437 phenotype 09/30/2013
25 70826 UTSW Erich6 0.054 R0744 G1 225 Y 3 58636122 T A splice site Het probably benign 09/30/2013
26 70820 UTSW Fbn1 0.878 R0744 G1 225 Y 2 125314814 T C splice site Het probably benign phenotype 09/30/2013
27 70832 UTSW Fryl 0.870 R0744 G1 225 Y 5 73089081 A T unclassified Het probably benign phenotype 09/30/2013
28 70839 UTSW Galnt17 0.000 R0744 G1 225 Y 5 131150916 D131V T A missense Het probably damaging 1.000 0.522 phenotype 09/30/2013
29 70831 UTSW Gm13089 0.062 R0744 G1 225 Y 4 143698486 M129K A T missense Het probably benign 0.190 0.090 09/30/2013
30 70812 UTSW Gm597 0.066 R0744 G1 225 Y 1 28777821 S377P A G missense Het possibly damaging 0.460 0.179 09/30/2013
31 474129 UTSW Gm6619 0.082 R0744 G1 225 N 6 131490334 L54Q T A missense Het probably damaging 0.974 04/14/2017
32 70848 UTSW Herc2 0.953 R0744 G1 225 Y 7 56206036 T C splice site Het probably benign phenotype 09/30/2013
33 70870 UTSW Hic1 0.458 R0744 G1 225 Y 11 75165801 Q754L T A missense Het possibly damaging 0.518 0.269 phenotype 09/30/2013
34 70824 UTSW Hnf4g 0.233 R0744 G1 225 Y 3 3651629 D286V A T missense Het possibly damaging 0.919 0.388 phenotype 09/30/2013
35 70891 UTSW Itgb5 0.000 R0744 G1 225 Y 16 33900583 K339R A G missense Het probably damaging 0.993 0.488 phenotype 09/30/2013
36 70880 UTSW Itih1 0.090 R0744 G1 225 Y 14 30941555 V164E A T missense Het probably damaging 0.999 0.309 phenotype 09/30/2013
37 70859 UTSW Jak3 0.524 R0744 G1 184 Y 8 71683978 N643T A C missense Het probably damaging 1.000 0.706 phenotype 09/30/2013
38 70853 UTSW Lamp1 0.000 R0744 G1 225 Y 8 13172654 F279L T A missense Het probably damaging 1.000 0.647 phenotype 09/30/2013
39 70874 UTSW Lrfn5 0.079 R0744 G1 225 Y 12 61839668 T81P A C missense Het probably damaging 1.000 0.633 phenotype 09/30/2013
40 70892 UTSW Lrrc58 0.201 R0744 G1 225 Y 16 37878573 A G splice site Het probably benign 09/30/2013
41 70883 UTSW March6 0.586 R0744 G1 225 Y 15 31480291 Y562C T C missense Het probably benign 0.002 0.312 phenotype 09/30/2013
42 70816 UTSW Mark1 0.273 R0744 G1 225 N 1 184921608 I166F T A missense Het probably damaging 1.000 09/30/2013
43 70902 UTSW Mark2 0.879 R0744 G1 225 Y 19 7285824 Y193H A G missense Het probably damaging 1.000 0.935 phenotype 09/30/2013
44 70879 UTSW Mast4 0.424 R0744 G1 225 Y 13 102737387 Q1632H C G missense Het probably damaging 0.983 0.090 phenotype 09/30/2013
45 70886 UTSW Mcrs1 1.000 R0744 G1 225 Y 15 99243449 T C unclassified Het probably benign phenotype 09/30/2013
46 70815 UTSW Mgst3 0.000 R0744 G1 225 Y 1 167373805 Y104H A G missense Het probably damaging 1.000 0.964 phenotype 09/30/2013
47 70840 UTSW Mlxipl 0.338 R0744 G1 225 Y 5 135132475 T416I C T missense Het possibly damaging 0.861 0.179 phenotype 09/30/2013
48 70833 UTSW Mthfd2l 0.000 R0744 G1 225 Y 5 90946942 V90A T C missense Het probably damaging 0.999 0.713 09/30/2013
49 70857 UTSW Mtnr1a 0.000 R0744 G1 220 Y 8 45087937 I312F A T missense Het probably benign 0.271 0.371 phenotype 09/30/2013
50 70827 UTSW Muc1 0.309 R0744 G1 225 Y 3 89230328 P159Q C A missense Het possibly damaging 0.921 0.139 phenotype 09/30/2013
51 70854 UTSW Myom2 0.121 R0744 G1 225 Y 8 15132924 K1454* A T nonsense Het probably null 0.965 phenotype 09/30/2013
52 70823 UTSW Myt1 1.000 R0744 G1 217 Y 2 181797505 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG intron Het probably benign phenotype 09/30/2013
53 70881 UTSW Olfr1513 0.173 R0744 G1 225 Y 14 52349378 I223V T C missense Het probably benign 0.001 0.109 phenotype 09/30/2013
54 474133 UTSW Olfr329-ps 0.076 R0744 G1 225 N 11 58543162 M105L T A missense Het possibly damaging 0.762 phenotype 04/14/2017
55 70850 UTSW Olfr504 0.055 R0744 G1 225 Y 7 108564998 T266A T C missense Het possibly damaging 0.572 0.332 phenotype 09/30/2013
56 70849 UTSW Olfr629 0.075 R0744 G1 225 N 7 103740925 H105R T C missense Het probably damaging 0.996 0.602 phenotype 09/30/2013
57 70861 UTSW Olfr905 0.076 R0744 G1 225 Y 9 38472785 I13F A T missense Het probably benign 0.035 0.090 phenotype 09/30/2013
58 70877 UTSW Pdcd6 0.000 R0744 G1 82 Y 13 74316324 A G splice site Het probably benign phenotype 09/30/2013
59 70884 UTSW Ppp1r16a 0.100 R0744 G1 225 Y 15 76693669 Q328* C T nonsense Het probably null 0.976 phenotype 09/30/2013
60 70845 UTSW Pzp 0.112 R0744 G1 225 Y 6 128516195 A G unclassified Het probably benign 0.090 phenotype 09/30/2013
61 70900 UTSW Rab27b 0.000 R0744 G1 225 Y 18 69987041 T C splice site Het probably benign 0.090 phenotype 09/30/2013
62 70885 UTSW Rapgef3 0.169 R0744 G1 225 Y 15 97761585 G A splice site Het probably benign phenotype 09/30/2013
63 70819 UTSW Rapsn 1.000 R0744 G1 138 Y 2 91036808 Y152H T C missense Het probably damaging 0.993 0.349 phenotype 09/30/2013
64 70895 UTSW Rgs11 0.190 R0744 G1 225 Y 17 26203318 M29K T A missense Het probably damaging 1.000 0.484 phenotype 09/30/2013
65 70882 UTSW Rictor 1.000 R0744 G1 225 Y 15 6764278 A G critical splice acceptor site Het probably null 0.948 phenotype 09/30/2013
66 70818 UTSW Rif1 1.000 R0744 G1 217 Y 2 52110324 GCCACCA GCCA unclassified Het probably benign 0.090 phenotype 09/30/2013
67 70811 UTSW Rims1 0.569 R0744 G1 225 Y 1 22427459 T C splice site 3 bp Het probably null 0.976 phenotype 09/30/2013
68 70843 UTSW Samd9l 0.000 R0744 G1 225 Y 6 3372725 E1512G T C missense Het possibly damaging 0.922 0.384 phenotype 09/30/2013
69 70836 UTSW Sgsm1 0.000 R0744 G1 225 Y 5 113279184 A127T C T missense Het probably benign 0.377 0.082 09/30/2013
70 70903 UTSW Slc22a28 0.197 R0744 G1 225 Y 19 8116833 Y245C T C missense Het possibly damaging 0.936 0.179 09/30/2013
71 70888 UTSW Slc25a1 1.000 R0744 G1 225 Y 16 17927436 H78L T A missense Het probably benign 0.038 0.290 09/30/2013
72 70834 UTSW Slc26a1 0.226 R0744 G1 225 Y 5 108673523 T167S T A missense Het probably benign 0.007 0.090 phenotype 09/30/2013
73 70865 UTSW Slc2a12 0.000 R0744 G1 225 Y 10 22702016 T C unclassified Het probably benign phenotype 09/30/2013
74 70828 UTSW Slc44a5 0.078 R0744 G1 162 Y 3 154265474 S654P T C missense Het probably damaging 0.996 0.804 09/30/2013
75 70890 UTSW Slc51a 0.224 R0744 G1 225 Y 16 32475849 T306S T A missense Het probably benign 0.026 0.198 phenotype 09/30/2013
76 70844 UTSW Slc6a13 0.264 R0744 G1 225 Y 6 121302867 W67G T G missense Het probably damaging 1.000 0.940 phenotype 09/30/2013
77 474132 UTSW Sowahc 0.498 R0744 G1 111 N 10 59223491 GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA unclassified Het probably benign 04/14/2017
78 70813 UTSW Sp100 0.228 R0744 G1 225 Y 1 85699744 I86L A T missense Het probably damaging 0.974 0.647 09/30/2013
79 70825 UTSW Supt20 0.934 R0744 G1 225 Y 3 54714701 Y409N T A missense Het probably damaging 0.998 0.172 phenotype 09/30/2013
80 70871 UTSW Synrg 1.000 R0744 G1 225 Y 11 84024305 Q1046* C T nonsense Het probably null 0.976 phenotype 09/30/2013
81 70863 UTSW Tab2 1.000 R0744 G1 225 Y 10 7907581 T C unclassified Het probably benign phenotype 09/30/2013
82 70899 UTSW Tcof1 1.000 R0744 G1 225 Y 18 60845832 D48G T C missense Het probably damaging 0.997 0.285 phenotype 09/30/2013
83 70855 UTSW Tex24 0.067 R0744 G1 225 Y 8 27344720 H92L A T missense Het possibly damaging 0.915 0.179 09/30/2013
84 70821 UTSW Tgm6 0.000 R0744 G1 225 Y 2 130151761 V640A T C missense Het probably benign 0.005 0.090 phenotype 09/30/2013
85 70867 UTSW Tle2 0.494 R0744 G1 225 Y 10 81588947 F667L T C missense Het probably damaging 0.999 0.779 09/30/2013
86 70864 UTSW Tnfaip3 0.000 R0744 G1 225 Y 10 19002949 A704S C A missense Het probably benign 0.089 0.063 phenotype 09/30/2013
87 70822 UTSW Tomm34 0.137 R0744 G1 225 Y 2 164070976 N22D T C missense Het probably benign 0.342 0.071 phenotype 09/30/2013
88 70829 UTSW Trabd2b 0.074 R0744 G1 225 Y 4 114580322 Q232R A G missense Het probably benign 0.003 0.068 09/30/2013
89 70830 UTSW Trim62 0.168 R0744 G1 225 Y 4 128884215 S16G A G missense Het probably damaging 0.999 0.150 phenotype 09/30/2013
90 70835 UTSW Ttc28 0.000 R0744 G1 225 Y 5 111231081 I1144N T A missense Het probably damaging 0.997 0.706 09/30/2013
91 70876 UTSW Unc5a 0.000 R0744 G1 225 Y 13 55003933 N56K C A missense Het possibly damaging 0.919 0.097 phenotype 09/30/2013
92 70817 UTSW Ush2a 0.674 R0744 G1 225 Y 1 188814406 C T splice site Het probably benign phenotype 09/30/2013
93 70856 UTSW Wrn 0.429 R0744 G1 225 Y 8 33295006 I446T A G missense Het possibly damaging 0.910 0.211 phenotype 09/30/2013
94 70838 UTSW Zbed5 0.000 R0744 G1 225 Y 5 129902272 V354E T A missense Het possibly damaging 0.915 0.179 phenotype 09/30/2013
95 70860 UTSW Zfp266 0.067 R0744 G1 225 Y 9 20499799 H361Y G A missense Het probably damaging 1.000 0.647 phenotype 09/30/2013
[records 1 to 95 of 95]