Incidental Mutations

36 incidental mutations are currently displayed, and affect 35 genes.
2 are Possibly Damaging.
19 are Probably Damaging.
10 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 36 of 36] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 98785 UTSW Atxn2l 0.906 R1022 G1 225 N 7 126497294 N425K A T missense Het probably benign 0.011 phenotype 01/09/2014
2 98805 UTSW Ccar2 0.523 R1022 G1 201 N 14 70140515 S674P A G missense Het probably damaging 1.000 phenotype 01/09/2014
3 98801 UTSW Cdc14b 0.367 R1022 G1 225 N 13 64215676 V257E A T missense Het probably damaging 1.000 phenotype 01/09/2014
4 98779 UTSW Cfap100 0.054 R1022 G1 225 N 6 90413004 T101S T A missense Het possibly damaging 0.495 01/09/2014
5 98790 UTSW Dock6 0.454 R1022 G1 225 N 9 21833612 L556H A T missense Het probably damaging 1.000 phenotype 01/09/2014
6 98778 UTSW Dqx1 0.061 R1022 G1 225 N 6 83061089 C486Y G A missense Het probably damaging 1.000 0.964 01/09/2014
7 98800 UTSW Drd1 0.319 R1022 G1 225 N 13 54053314 M294L T A missense Het probably benign 0.001 phenotype 01/09/2014
8 98772 UTSW Extl1 0.369 R1022 G1 106 N 4 134357677 TGCGTTGCACCGATACCGGG TG unclassified Het probably benign 0.090 phenotype 01/09/2014
9 98802 UTSW Fcho2 1.000 R1022 G1 225 N 13 98732659 I568N A T missense Het probably damaging 0.998 01/09/2014
10 98784 UTSW Folr1 1.000 R1022 G1 225 N 7 101858603 M210T A G missense Het probably damaging 0.979 phenotype 01/09/2014
11 98775 UTSW Gatc 0.676 R1022 G1 122 N 5 115340845 T A unclassified 4797 bp Het probably null 01/09/2014
12 98806 UTSW H1fnt 0.175 R1022 G1 225 N 15 98256755 T171I G A missense Het unknown phenotype 01/09/2014
13 98774 UTSW Hnrnpd 0.830 R1022 G1 225 N 5 99966157 *87L C A makesense Het probably null phenotype 01/09/2014
14 98776 UTSW Hpd 0.131 R1022 G1 148 N 5 123174469 R279H C T missense Het possibly damaging 0.939 phenotype 01/09/2014
15 98810 UTSW Igfals 0.000 R1022 G1 136 N 17 24880483 V183M G A missense Het probably damaging 0.990 phenotype 01/09/2014
16 98811 UTSW March2 0.085 R1022 G1 225 N 17 33709788 G45C C A missense Het probably damaging 1.000 phenotype 01/09/2014
17 98794 UTSW Myo15 0.000 R1022 G1 121 N 11 60479616 R1067S A T missense Het probably benign 0.001 phenotype 01/09/2014
18 98783 UTSW Nell1 1.000 R1022 G1 225 N 7 50120663 S157G A G missense Het probably damaging 1.000 phenotype 01/09/2014
19 98795 UTSW Nf1 1.000 R1022 G1 225 N 11 79547033 E2072D A T missense Het probably damaging 0.995 phenotype 01/09/2014
20 98781 UTSW Nop2 0.966 R1022 G1 225 N 6 125137186 V205E T A missense Het probably benign 0.017 phenotype 01/09/2014
21 98812 UTSW Nudt8 0.145 R1022 G1 119 N 19 4001925 W179R T A missense Het probably damaging 1.000 01/09/2014
22 98804 UTSW Olfr729 0.120 R1022 G1 225 N 14 50147927 F316I A T missense Het probably benign 0.000 phenotype 01/09/2014
23 98803 UTSW Otx2 1.000 R1022 G1 106 N 14 48659272 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 01/09/2014
24 98798 UTSW Prl5a1 0.058 R1022 G1 225 N 13 28149897 V128I G A missense Het probably damaging 0.973 01/09/2014
25 98791 UTSW Pth1r 1.000 R1022 G1 225 N 9 110729621 D96G T C missense Het probably benign 0.008 phenotype 01/09/2014
26 98792 UTSW Pth1r 1.000 R1022 G1 123 N 9 110742227 L25Q A T missense Het probably damaging 0.959 phenotype 01/09/2014
27 98807 UTSW Rwdd2b 0.000 R1022 G1 225 N 16 87436850 C121S A T missense Het probably damaging 1.000 01/09/2014
28 98793 UTSW Scn10a 0.218 R1022 G1 225 N 9 119609274 I1843T A G missense Het probably damaging 1.000 phenotype 01/09/2014
29 98799 UTSW Sirt5 0.000 R1022 G1 225 N 13 43370769 I6V A G missense Het probably benign 0.049 phenotype 01/09/2014
30 98808 UTSW Slc5a3 1.000 R1022 G1 225 N 16 92077495 A147T G A missense Het probably damaging 0.999 phenotype 01/09/2014
31 98769 UTSW Stxbp1 0.768 R1022 G1 165 N 2 32814967 T C unclassified 2335 bp Het probably null phenotype 01/09/2014
32 98782 UTSW Syt3 0.155 R1022 G1 198 N 7 44390682 G113V G T missense Het probably damaging 0.989 01/09/2014
33 98780 UTSW Tatdn2 1.000 R1022 G1 194 N 6 113709545 T644A A G missense Het probably damaging 0.997 01/09/2014
34 98797 UTSW Trim9 0.224 R1022 G1 225 N 12 70252017 T A splice site 3 bp Het probably null phenotype 01/09/2014
35 98814 UTSW Tut1 0.574 R1022 G1 225 N 19 8959355 N181S A G missense Het probably benign 0.000 phenotype 01/09/2014
36 98809 UTSW Vmn2r90 0.110 R1022 G1 225 N 17 17728138 I549F A T missense Het probably damaging 1.000 01/09/2014
[records 1 to 36 of 36]