Incidental Mutations

31 incidental mutations are currently displayed, and affect 31 genes.
5 are Possibly Damaging.
11 are Probably Damaging.
12 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 31 of 31] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 95523 UTSW Aasdh 0.191 R1035 G1 212 Y 5 76876283 T174M G A missense Het probably damaging 1.000 0.647 phenotype 01/05/2014
2 95537 UTSW Ap3b2 0.170 R1035 G1 225 Y 7 81463911 L850Q A T missense Het unknown 0.087 phenotype 01/05/2014
3 95582 UTSW Asxl3 0.394 R1035 G1 225 Y 18 22525049 S2039P T C missense Het probably damaging 1.000 0.105 01/05/2014
4 95572 UTSW Cadm2 0.542 R1035 G1 225 Y 16 66815347 M109K A T missense Het probably damaging 0.997 0.152 phenotype 01/05/2014
5 95575 UTSW Caskin1 0.133 R1035 G1 103 Y 17 24505037 N933S A G missense Het probably damaging 0.999 0.072 01/05/2014
6 95509 UTSW Cbln4 0.258 R1035 G1 225 Y 2 172042069 N77S T C missense Het possibly damaging 0.783 0.114 phenotype 01/05/2014
7 95543 UTSW Chek1 1.000 R1035 G1 225 Y 9 36716473 I256T A G missense Het probably damaging 1.000 0.493 phenotype 01/05/2014
8 95541 UTSW Col5a3 0.242 R1035 G1 225 Y 9 20793499 A T splice site Het probably benign 0.090 phenotype 01/05/2014
9 95533 UTSW Cyp2b10 0.120 R1035 G1 225 Y 7 25917048 S360L C T missense Het probably benign 0.337 0.090 phenotype 01/05/2014
10 95529 UTSW Dctn1 1.000 R1035 G1 215 Y 6 83190220 S222P T C missense Het probably damaging 0.999 0.122 phenotype 01/05/2014
11 95497 UTSW Dnah7b 0.119 R1035 G1 225 Y 1 46124448 I471V A G missense Het probably benign 0.000 0.090 01/05/2014
12 95559 UTSW Ear2 0.064 R1035 G1 225 Y 14 44102887 M1L A T start codon destroyed Het possibly damaging 0.588 0.815 01/05/2014
13 95505 UTSW Entpd6 0.000 R1035 G1 198 Y 2 150764192 T A splice site Het probably benign 0.090 phenotype 01/05/2014
14 95517 UTSW Extl1 0.316 R1035 G1 183 Y 4 134357677 TGCGTTGCACCGATACCGGG TG unclassified Het probably benign 0.090 phenotype 01/05/2014
15 95503 UTSW Fam98b 0.789 R1035 G1 225 Y 2 117270639 R311W C T missense Het possibly damaging 0.844 0.182 01/05/2014
16 95507 UTSW Ggt7 0.517 R1035 G1 225 Y 2 155506427 C102S A T missense Het probably damaging 0.999 0.347 phenotype 01/05/2014
17 95553 UTSW Myo15 0.000 R1035 G1 225 Y 11 60510558 T C unclassified Het probably benign phenotype 01/05/2014
18 95535 UTSW Nlrp9c 0.000 R1035 G1 225 Y 7 26371277 C T splice site Het probably benign 0.090 01/05/2014
19 95580 UTSW Nrxn1 0.000 R1035 G1 225 Y 17 90163874 N1234K A T missense Het probably damaging 0.963 0.118 phenotype 01/05/2014
20 95571 UTSW Olfr201 0.122 R1035 G1 225 Y 16 59268944 C241Y C T missense Het probably damaging 1.000 0.647 phenotype 01/05/2014
21 95557 UTSW Pcsk1 1.000 R1035 G1 225 Y 13 75132119 S688P T C missense Het probably benign 0.000 0.061 phenotype 01/05/2014
22 95527 UTSW Polr1a 1.000 R1035 G1 225 Y 6 71967916 F1319L T C missense Het probably benign 0.000 0.061 phenotype 01/05/2014
23 95501 UTSW Ppig 0.820 R1035 G1 225 Y 2 69749459 Y446H T C missense Het unknown 0.067 01/05/2014
24 95499 UTSW Stk17b 0.110 R1035 G1 225 Y 1 53762599 T88A T C missense Het probably benign 0.220 0.167 phenotype 01/05/2014
25 95525 UTSW Tas2r143 0.053 R1035 G1 225 Y 6 42400265 I10F A T missense Het probably benign 0.155 0.090 01/05/2014
26 95549 UTSW Theg 0.000 R1035 G1 225 Y 10 79583850 T182M G A missense Het probably damaging 1.000 0.647 phenotype 01/05/2014
27 95565 UTSW Tmprss12 0.074 R1035 G1 205 Y 15 100285200 R141Q G A missense Het probably benign 0.184 0.090 01/05/2014
28 95495 UTSW Trpa1 0.161 R1035 G1 225 Y 1 14891303 A G critical splice donor site 2 bp Het probably null 0.949 phenotype 01/05/2014
29 95561 UTSW Txndc16 0.102 R1035 G1 225 Y 14 45172563 S187P A G missense Het possibly damaging 0.915 0.179 01/05/2014
30 95573 UTSW Vmn2r98 0.143 R1035 G1 225 Y 17 19080749 I671T T C missense Het possibly damaging 0.902 0.179 01/05/2014
31 95531 UTSW Zfp78 0.089 R1035 G1 225 Y 7 6378661 V237F G T missense Het probably damaging 0.997 0.647 01/05/2014
[records 1 to 31 of 31]