Incidental Mutations

47 incidental mutations are currently displayed, and affect 45 genes.
4 are Possibly Damaging.
16 are Probably Damaging.
21 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 47 of 47] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 165214 UTSW 2810021J22Rik 0.084 R1148 G1 225 Y 11 58876718 S14P T C missense Het probably damaging 0.971 0.647 03/28/2014
2 165196 UTSW Ablim2 0.302 R1148 G1 225 Y 5 35809261 F178S T C missense Het probably damaging 1.000 0.915 03/28/2014
3 165203 UTSW AC149051.1 0.133 R1148 G1 225 Y 8 63926855 L981P A G missense Het probably damaging 0.987 0.647 03/28/2014
4 165221 UTSW Alg10b 1.000 R1148 G1 225 Y 15 90227865 F304S T C missense Het possibly damaging 0.670 0.236 phenotype 03/28/2014
5 165211 UTSW Ank3 0.834 R1148 G1 225 Y 10 69882539 S540F C T missense Het probably damaging 1.000 0.270 phenotype 03/28/2014
6 165195 UTSW Arhgef16 0.000 R1148 G1 150 Y 4 154280889 N590D T C missense Het probably benign 0.051 0.090 phenotype 03/28/2014
7 165224 UTSW Arsi 0.085 R1148 G1 167 Y 18 60916651 G202E G A missense Het probably benign 0.068 0.063 phenotype 03/28/2014
8 165206 UTSW Bbs9 0.720 R1148 G1 225 N 9 22575100 T C splice site Het probably benign phenotype 03/28/2014
9 165227 UTSW Cfap58 0.273 R1148 G1 225 Y 19 47988504 H731Y C T missense Het probably damaging 0.958 0.133 03/28/2014
10 165208 UTSW Cilp 0.000 R1148 G1 225 Y 9 65280316 L1231Q T A missense Het possibly damaging 0.956 0.179 phenotype 03/28/2014
11 165186 UTSW Coq8a 0.704 R1148 G1 225 N 1 180169403 G A splice site Het probably benign phenotype 03/28/2014
12 165194 UTSW Cyp4x1 0.132 R1148 G1 225 Y 4 115126555 A G splice site Het probably benign 0.090 phenotype 03/28/2014
13 165185 UTSW Dars 0.965 R1148 G1 225 N 1 128366909 T C splice site Het probably benign phenotype 03/28/2014
14 500207 UTSW Disp2 0.826 R1148 G1 200 N 2 118806418 G A critical splice donor site 1 bp Het probably null phenotype 12/01/2017
15 165217 UTSW Dnah5 0.818 R1148 G1 225 Y 15 28421690 L3896P T C missense Het probably damaging 1.000 0.340 phenotype 03/28/2014
16 165207 UTSW Dpp8 0.523 R1148 G1 225 Y 9 65053832 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 03/28/2014
17 165223 UTSW Esp4 0.062 R1148 G1 225 Y 17 40602371 N43T A C missense Het probably benign 0.032 0.090 03/28/2014
18 165205 UTSW Fat3 0.576 R1148 G1 225 Y 9 15996774 D2644G T C missense Het probably damaging 0.999 0.251 phenotype 03/28/2014
19 165198 UTSW Fgd5 0.633 R1148 G1 225 Y 6 91987631 K124E A G missense Het probably benign 0.000 0.090 phenotype 03/28/2014
20 165200 UTSW Folh1 0.000 R1148 G1 225 Y 7 86761730 D268G T C missense Het probably damaging 1.000 0.571 phenotype 03/28/2014
21 500209 UTSW Gm10608 0.082 R1148 G1 155 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 12/01/2017
22 165215 UTSW Hexdc 0.108 R1148 G1 225 Y 11 121221267 I438V A G missense Het probably benign 0.088 0.088 03/28/2014
23 165204 UTSW Lonp2 0.255 R1148 G1 225 Y 8 86636540 E262G A G missense Het probably benign 0.001 0.090 phenotype 03/28/2014
24 165218 UTSW Ly6h 0.065 R1148 G1 222 Y 15 75565172 S118R G T missense Het unknown 0.328 03/28/2014
25 165220 UTSW Mapk12 0.000 R1148 G1 225 Y 15 89134623 Y203C T C missense Het probably damaging 1.000 0.919 phenotype 03/28/2014
26 262441 UTSW Mapk15 0.000 R1148 G1 49 Y 15 75998155 T375A A G missense Het probably benign 0.000 0.090 02/04/2015
27 165213 UTSW Morc2a 1.000 R1148 G1 225 Y 11 3678557 N337D A G missense Het probably benign 0.004 0.059 phenotype 03/28/2014
28 165202 UTSW Nsd3 0.507 R1148 G1 225 Y 8 25713380 D1307G A G missense Het probably benign 0.094 0.090 phenotype 03/28/2014
29 165188 UTSW Olfr1009 0.067 R1148 G1 225 Y 2 85722276 Y290* C A nonsense Het probably null 0.976 phenotype 03/28/2014
30 165222 UTSW Osbpl11 1.000 R1148 G1 225 Y 16 33227212 F515S T C missense Het probably damaging 0.999 0.659 phenotype 03/28/2014
31 165212 UTSW Pcdh15 0.000 R1148 G1 225 Y 10 74170560 V90A T C missense Het probably damaging 1.000 0.137 phenotype 03/28/2014
32 165183 UTSW Ptpn4 0.209 R1148 G1 225 N 1 119675709 T A splice site Het probably benign phenotype 03/28/2014
33 165184 UTSW Ptpn4 0.209 R1148 G1 225 Y 1 119684540 D41G T C missense Het probably damaging 0.986 0.077 phenotype 03/28/2014
34 262812 UTSW Rbm4b 0.000 R1148 G1 29 Y 19 4757499 H81R A G missense Het probably damaging 0.977 0.427 phenotype 02/04/2015
35 165226 UTSW Ric1 0.481 R1148 G1 225 Y 19 29579849 Y445H T C missense Het probably benign 0.000 0.090 03/28/2014
36 165201 UTSW Sez6l2 0.000 R1148 G1 225 Y 7 126961812 P483Q C A missense Het probably damaging 0.998 0.144 phenotype 03/28/2014
37 102532 UTSW Sfi1 0.243 R1148 G1 217 N 11 3146254 TCGC TC frame shift Het probably null 01/15/2014
38 102533 UTSW Sfi1 0.243 R1148 G1 214 N 11 3177419 CCTCTC CCTCTCTC critical splice donor site Het probably benign 01/15/2014
39 165192 UTSW Sh3d19 0.000 R1148 G1 225 Y 3 86107327 D475G A G missense Het possibly damaging 0.820 0.178 phenotype 03/28/2014
40 165210 UTSW Shprh 0.000 R1148 G1 225 Y 10 11213482 S1655P T C missense Het possibly damaging 0.947 0.112 Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators] (source: MGI)">phenotype 03/28/2014
41 165187 UTSW Slc25a12 0.227 R1148 G1 225 Y 2 71312568 G A splice site Het probably benign phenotype 03/28/2014
42 165190 UTSW Strc 0.187 R1148 G1 225 Y 2 121372077 A G intron Het probably benign 0.090 phenotype 03/28/2014
43 500208 UTSW Ttc22 0.070 R1148 G1 143 N 4 106623031 V161M G A missense Het probably damaging 1.000 0.647 phenotype 12/01/2017
44 165216 UTSW Unc79 1.000 R1148 G1 225 Y 12 103112667 L1504P T C missense Het probably damaging 0.998 0.075 phenotype 03/28/2014
45 165225 UTSW Vldlr 0.372 R1148 G1 225 Y 19 27241291 N514S A G missense Het probably benign 0.011 0.086 phenotype 03/28/2014
46 165199 UTSW Wnk1 1.000 R1148 G1 225 N 6 119952006 A G splice site Het probably benign phenotype 03/28/2014
47 165197 UTSW Wsb2 0.000 R1148 G1 225 N 5 117370677 T C splice site Het probably benign phenotype 03/28/2014
[records 1 to 47 of 47]